Health Dictionary Find a Doctor

Box gene transcriptions

Editor-In-Chief: Henry A. Hoff

“[A] repeating sequence of nucleotides that forms a transcription or a regulatory signal”[1] is a box.

Genetics

File:Bob, the guinea pig.jpg
This is an image of Bob, the guinea pig. Credit: selbst.

Genetics involves the expression, transmission, and variation of inherited characteristics.

Def. a “branch of biology that deals with the transmission and variation of inherited characteristics,[2] in particular chromosomes and DNA[3] is called genetics.

Theoretical box genetics

Def. one “of two specific regions in a promoter”[4] is called a box.

AGC boxes

File:Arabidopsis thaliana habito.jpg
This is a digital photograph of Arabidopsis thaliana. Credit: Alberto Salguero Quiles en Getafe (Madrid), España.

“[T]he AGC box (10), GCC element (11), or AGCCGCC sequence (13), is an ethylene-responsive element found in the promoters of a large number of [pathogenesis related] PR genes”.[5]

ATA boxes

The ATA box is a variant of the TATA box that appears in the globin and other genes. Instead of a sequence TATA as in the TATA box, the ATA box lacks the first thymine (T) and may be tissue specific.

An ATA box may have the sequence AAATAT.[6]

CAAT boxes

File:Alosa fallax.jpg
As representative of the Metazoa here is an image of a twaid shad. Credit: Hans Hillewaert.

A CCAAT box (also sometimes abbreviated a CAAT box or CAT box) is a distinct pattern of nucleotides along the template strand of DNA in eukaryotes.

CArG boxes

File:Smooth muscle cell CArG.jpeg
The diagram shows a model for epigenetic regulation of SRF binding to CArG box chromatin. Credit: Oliver G. McDonald, Brian R. Wamhoff, Mark H. Hoofnagle, and Gary K. Owens.

CArG boxes are present in the promoters of smooth muscle cell genes.

“CArG box [CC(A/T)6GG] DNA [consensus] sequences present within the promoters of SMC genes play a pivotal role in controlling their transcription”.[7]

C/D boxes

File:RF00071.jpg
This example of a C/D box is a small nucleolar RNA 73 (snoRNA U73). Credit: Rfam database (RF00071).

“Located within the introns of very long transcripts extending downstream of SNRPN, there are clusters of paternally expressed C/D box–containing snoRNAs that are highly expressed in the brain5,6.”[8]

For “box C/D snoRNAs, boxes C and D and an adjoining stem form a vital structure, known as the box C/D motif.”[9]

“The [C and D] box elements are essential for snoRNA production [transcription] and for snoRNA-directed modification of rRNA nucleotides.”[9]

CENP-B boxes

File:CENP-B box.png
The 17-bp motif of the CENP-B box repeats in DNA monomers. Credit: Jun-ichirou Ohzeki, Megumi Nakano, Teruaki Okada, Hiroshi Masumoto.

“The human α-satellite consensus sequence contains only three CpG sequences within its 171 base-pair sequence [23]. Interestingly, two of the three CpG sequences in the α-satellite consensus sequence are located within site 1 (5′-pTpTpCpG-3′) and site 3 (5′-pCpGpGpG-3′) of the CENP-B box (Fig. 1A;[9]).”[10]

CGCG boxes

“The minimum DNA-binding elements are 6-bp CGCG box, (A/C/G)CGCG(C/G/T).”[11]

“The promoter regions are assumed to be within ∼1 kb upstream of the starting transcription site (for the known genes) or the first ATG (for the predicted genes). These genes are related to ethylene signaling (EIN3) and ABA signaling (a putative ABA responsive protein), light perception (phytochrome A, phyA), stress responsive such as the DNA repairing protein, heat shock protein, touch protein (TCH 4), and CaM-regulated ion channel. CaM genes (CaM2 andCaM3) and AtSR6 also contains CGCGcis-elements in their promoter regions.”[11]

Chromoboxes

Notation: let chromo stand for chromatin organization modifier.[12]

A “[c]hromatin organization modifier (chromo) domain is a conserved region of around 50 amino acids found in a variety of chromosomal proteins, which appear to play a role in the functional organization of the eukaryotic nucleus.”[13]

DREB boxes

It “is likely that the present OsDREBL may preferably bind to other elements such as the ethylene responsive element GCC box (AGCCGCC), rather than the CRT/DREB box (TACCGACAT), since the two boxes were very similar.”[14]

“Based on DNA-binding data, this group [one AP2/ERF domain only] has been subdivided into dehydration-responsive element-binding (DREB)-like proteins, which interact with the dehydration-responsive, or cold-repeat, element (consensus sequence TACCGACAT) (Liu et al. 1998; Stockinger et al. 1997) and the EREBP-like (ethylene responsive element binding protein) proteins binding the GCC box (consensus sequence AGCCGCC) (Ohme-Takagi and Shinshi 1995; Sakuma et al. 2002).”[15]

Enhancer boxes

File:Klatre08.jpg
This is an image of Dendromus mysticalis, the chestnut climbing mouse. Credit: Kenneth Worm.

An E-box (Enhancer Box) is a DNA sequence which usually lies upstream of a gene in a promoter region.

E2 boxes

“The most dramatic impact on immunoglobulin gene enhancer activity was observed upon mutation of sites that contain an E2-box motif (G/ACAGNTGN).”[16]

“The E box sites that are most important are those of the E2 box class (GCAGXTGG/T). Two E2 box sites are present in the immunoglobulin heavy chain gene enhancer, p.E2 and /~E5, and one is present in the kappa enhancer, designated KE2 [29-31].”[17]

F boxes

“The F-box is a protein motif of approximately 50 amino acids that functions as a site of protein-protein interaction.”[18]

“The F-box of Elongin A binds Elongin C (El C). The association of Elongins B and C with A increases Elongin A transcriptional activity.”[18]

“SCF complexes generally recognize substrates after they are phosphorylated on specific epitopes [10]. Phosphorylation is one of the major mechanisms used by cells to rapidly transduce signals. SCF complexes are therefore ideal for dynamic processes that require an abrupt change to be made irreversible (at least in the short term) via the degradation of key proteins. Examples of such processes are cell-cycle phase transitions – during which the cell-cycle regulators that were required for the previous phase are degraded as the cell enters the new phase – and shifts in transcription that last for a longer time period than otherwise because a transcriptional inhibitor is degraded. There is a wide variety of SCF targets that include cell-cycle regulators, for example, G1-phase cyclins, cyclin-dependent kinase inhibitors, DNA replication factors, and transcription factors that promote cell-cycle progression, as well as non-cell-cycle functions, such as a cytoskeletal regulator, cell-surface receptors, transcription-factor inhibitors, and non-cell-cycle transcription factors (Table 2).”[18]

“Second, Elongin A, the transcriptionally active subunit of the Elongin (SIII) complex – which facilitates transcription elongation by RNA polymerase II [16] – is an F-box protein (Figure 2c). Elongin A was isolated by virtue of its ability to increase the catalytic rate of transcript elongation by RNA polymerase II in vitro [16]. Binding of the other components of the complex, Elongin B and C, increases the specific activity of Elongin A. The F-box motif of Elongin A is in the smallest region shown to be sufficient for Elongin A to bind Elongin C in both yeast and humans [17,18]. Elongin C has homology to Skp1; the F-box-Elongin C interaction may therefore be evolutionarily conserved.”[18]

Forkhead boxes

Forkhead “is named for the Drosophila fork head protein, a transcription factor which promotes terminal rather than segmental development.”[19]

Fur boxes

Notation: Let Fur stand for ferric uptake regulation.

“The Fur protein […] acts as a transcriptional repressor of iron-regulated promoters by virtue of its Fe2+-dependent DNA binding activity (5, 25, 32, 33).”[20]

“Under iron-rich conditions Fur binds the divalent ion, acquires a configuration able to bind target DNA sequences (generally known as Fur boxes or iron boxes, […]), and inhibits transcription from virtually all the genes and operons repressed by the metal.”[20]

When “iron is scarce, the equilibrium is displaced to release Fe2+, the RNA polymerase accesses cognate promoters, and the genes for the biosynthesis of siderophores and other iron-related functions are expressed (41, 55).”[20]

The “sequence 5′-GATAATGATAATCATTATC-3′ [is] the functional target of the Fur protein.”[20]

Many “iron-regulated promoters appear to have not just one Fur box but multiple, sometimes overlapping, boxes (42, 53, 87)”[20]

The “same 19-bp sequence [5′-GATAATGATAATCATTATC-3′] can be viewed as a combination of three adjacent repeats, 5′-NATA/TAT-3′.”[20]

G boxes

The “perfect palindrome 5′-GCCACGTGGC-3′ which is also known as the G-box motif.”[21]

“TAF-1 can bind to the G-box and related motifs and that it functions as a transcription activator.”[21]

“A G-box-related motif, containing the core sequence CACGTG is also present in the 5′ regions of two other classes of light-responsive genes”.[21]

GC boxes

A GC box is a distinct pattern of nucleotides found in the promoter region of some eukaryotic genes upstream of the TATA box and approximately 110 bases upstream from the transcription initiation site.

GCC boxes

The “EREBP-like (ethylene responsive element binding protein) proteins [bind] the GCC box (consensus sequence AGCCGCC) (Ohme-Takagi and Shinshi 1995; Sakuma et al. 2002).”[15]

H boxes

An H box has a consensus sequence of 3′-ACACCA-5′.[22]

HMG boxes

“Upstream Binding Factor (UBF) is important for activation of ribosomal RNA transcription and belongs to a family of proteins containing nucleic acid binding domains, termed HMG-boxes, with similarity to High Mobility Group (HMG) chromosomal proteins.”[23]

“Most HMG box proteins contain two or more HMG boxes and appear to bind DNA in a relatively sequence-aspecific manner (5, 13, 15, 16 and references therein). […] they all appear to bind to the minor groove of the A/T A/T C A A A G-motif (10, 14, 18-20).”[24]

“In mammals, the Tcf/Lef family consists of four genes: Tcf‐1, Lef‐1, Tcf‐3 and Tcf‐4. All TCF/LEF proteins display several common structural features (48,49). They contain a nearly identical DNA‐binding domain, the HMG box, recognizing the consensus sequence A/T A/T CAAA.”[25]

HY boxes

A core responsive element is the hypertrophy region HY box between -89 and -60 nucleotides (nts) upstream from the transcription start site.[26]

MADS boxes

“The MADS-box encodes a novel type of DNA-binding domain found so far in a diverse group of transcription factors from yeast, animals, and seed plants.”[27]

“The MADS-box comprises 180 nucleotides, encoding 60 amino acids […] MADS is an acronym for the four DNA-binding proteins MCM1 [minichromosome maintenance gene 1], AGAMOUS […], DEFICIENS […], and SRF [serum response factor].”[27]

The “[Antirrhinum majus mutant squamosa(squa)] SQUA is a member of a family of transcription factors which contain the MADS-box, a conserved DNA binding domain.”[28]

The “MADS-box is […] AGAGGGAAAGTACAACTGAAGAGGATAGAGAACAAGATCAATAGACAGGTGACTTT CTCAAAGAGGAGAGGTGGATTGTTGAAAAAAGCTCATGAGCTCTCTGTGCTTTGTG ATGCTGAAGTGGCTCTTATTGTCTTCTCTAATAAGGGGAAGCTATTTGAGTATTCT ACTGAT”,[28] which has 174 nucleotides (nts) and begins with the nucleotides for the amino acids RGK.[28] The six nucleotides following the MADS box are “TCTTGC”[28] which may be the additional six needed to get to 180 nts.

P boxes

“As VRI [target gene: vrille (VRI)] accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus A(/G)TTA(/T)T(/C):GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004).”[29]

“REV-ERBα and RORa are nuclear receptors rather than bZIP transcription factors like VRI and PDP1ϵ, and they regulate transcription by binding RORE elements rather than V/P-boxes (Bell-Pedersen et al., 2005).”[29]

Pribnow boxes

“Although the first five bases of the conserved sequence are identical to the first five bases of the Pribnow box (TATAA), the sixth base of the Pribnow box is a 100 per cent conserved T (refs 15-17) while the 100 per cent conserved A found here is actually more similar to eukaryotic promoter sequences20.”[30]

“Two domains upstream of the start site of transcription have been identified for which a consensus sequence has been formulated(1-5). These domains are the -35 sequence (5′-T-T-G-A-C-A) and the Pribnow box (5′-T-A-T-A-A-T) in the -10 region. Both domains are in close contact with the RNA polymerase during initiation of RNAsynthesis (2,6).”[31]

Prolamin boxes

“The BPBF [barley prolamin-box (P-box) binding factor] expressed in bacteria as a GST-fusion binds a P-box 5′-TGTAAAG-3′ containing oligonucleotide derived from the promoter region of anHor2gene.”[32]

“The primary structure of hordein [barley prolamins] polypeptides is closely related to that of prolamins from other grass species from the Pooideae subfamily, such as wheat and rye (Shewry & Tatham 1990;Shewry et al. 1995). The close evolutionary relationship is also manifested by the conservation of a putative regulatory element in their gene promoters, the endosperm box (Forde et al. 1985;Kreis et al. 1985). This conserved region consists of two motifs, a 7 bp element (5′TGTAAAG3′) termed the Prolamin Box (P-box) or endosperm motif (EM) followed at a distance of up to 8 nucleotides by the GCN4-like motif (GLM) which has the 5′(G/A)TGA(G/C)TCA(T/C)3′ consensus sequence (reviewed by Müller et al. 1995).”[32]

Pyrimidine boxes

“Functional analyses of a number of hydrolase gene promoters, induced by gibberellin (GA) in aleurone cells following germination, have identified a GA-responsive complex as a tripartite element containing a pyrimidine box motif 5′-CCTTTT-3′.”[33]

“Although this GARC [GA responsive complex] may not always be tripartite, most often it includes three sequence motifs, the TAACAAA box or GA responsive element (GARE), the pyrimidine box CCTTTT, and the TATCCAC box (Skriver et al., 1991;Gubler and Jacobsen, 1992; Rogers et al., 1994).”[33]

The “complementary strand of the pyrimidine box element (5′-CTTTT-3′) in GA-induced hydrolase gene promoters was identical to the core sequence (5′-AAAAG-3′) recognized by PBF in prolamin gene promoters (P-box: 5′-T/AAAAG-3′; Vicente-Carbajosa et al., 1997; Mena et al., 1998; Yanagisawa and Schmidt, 1999)”.[33]

TACTAAC boxes

“The comparison of the two rp51 genes […] suggests that this homology might be more extensive if one allows up to 3 bases to differ from a larger consensus sequence, ATTTACTAAC.”[34]

“A consensus sequence TACTAA(C/T) was derived for the branch site of Dictyostelium introns.”[35]

T boxes

The T box is a DNA-binding domain.[36]

“T-box genes encode transcription factors involved in the regulation of developmental processes.”[36]

TATA boxes

File:Haloquadratum walsbyi00.jpg
This image is a drawing of Haloquadratum walsbyi. Credit: Rotational.

The TATA box (also called Goldberg-Hogness box)[37] is a DNA sequence (cis-regulatory element) found in the promoter region of genes in archaea and eukaryotes;[38] approximately 24% of human genes contain a TATA box within the core promoter.[39]

The TATA box is a “binding site of either general transcription factors or histones.

U boxes

“The U box is a domain of ∼70 amino acids that is present in proteins from yeast to humans.”[40]

“The prototype U box protein, yeast Ufd2, was identified as a ubiquitin chain assembly factor that cooperates with a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme (E2), and a ubiquitin-protein ligase (E3) to catalyze ubiquitin chain formation on artificial substrates.”[40]

“The UFD2 protein and its homologs in other eukaryotes share a conserved domain designated the ‘U box’.”[41]

“The U box mediates the interaction of UFD2 with ubiquitin conjugated proteins […] the U box is a derived version of the RING-finger domain that lacks the hallmark metal-chelating residues of the latter [5,6] but is likely to function similarly to the RING-finger in mediating ubiquitin-conjugation of protein substrates.”[41]

X boxes

“The so-called X (or X1) box in the promoter of the human MHC class II DRA gene is the binding site for a ubiquitous mammalian sequence-specific DNA-binding protein called RFX, NF-X, NF-Xc, or RFX1 (4,19,23,24,27).”[42]

“RFX is MDBP […] the MDBP (RFX) recognition site region in the DRA promoter can be considered to extend from positions -100 to -112 […] a possible binding site for MDBP which begins 88 bp after the first residue of the presumably full-length RFX1 (MDBP) cDNA (26). This site (RFX+88) is as follows: 5′-GTTGGCATGGCAAC-3′.”[42]

Y boxes

The “Y-box [is] an inverted CCAAT box, in the promoter region of many genes; this domain is highly conserved in evolution [1, 3, 4].”[43]

Hypotheses

  1. A1BG is not transcribed by any of the boxes.

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

Initial content for this page in some instances came from Wikiversity.

See also

References

  1. “Box (disambiguation)”. San Francisco, California: Wikimedia Foundation, Inc. 23 May 2013. Retrieved 2013-06-15.
  2. SemperBlotto (6 November 2005). “genetics”. San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2014-05-07.
  3. 78.149.117.24 (22 December 2008). “genetics”. San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2014-05-07.
  4. Fabgil (22 October 2015). box. San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2017-04-04.
  5. Michael Büttner and Karam B. Singh (27 May 1997). Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein”. Proceedings of the National Academy of Sciences of the United States of America. 94 (11): 5961–6. Retrieved 2014-05-02.
  6. Shigemi Kimura, Kuniya Abe, Misao Suzuki, Masakatsu Ogawa, Kowashi Yoshioka, Tadasi Kaname, Teruhisa Miike and Ken-ichi Yamamura (June 1997). “A 900 bp genomic region from the mouse dystrophin promoter directs lacZ reporter expression only to the right heart of transgenic mice”. Development, Growth & Differentiation. 39 (3): 257–65. doi:10.1046/j.1440-169X.1997.t01-2-00001.x. Retrieved 2013-06-28.
  7. Oliver G. McDonald, Brian R. Wamhoff, Mark H. Hoofnagle, and Gary K. Owens (4 January 2006). “Control of SRF binding to CArG box chromatin regulates smooth muscle gene expression in vivo”. The Journal of Clinical Investigation. 116 (1): 36–48. Retrieved 2014-06-05.
  8. Trilochan Sahoo, Daniela del Gaudio, Jennifer R German, Marwan Shinawi, Sarika U Peters, Richard E Person, Adolfo Garnica, Sau Wai Cheung, and Arthur L Beaudet (June 2008). “Prader-Willi phenotype caused by paternal deficiency for the HBII-85 C/D box small nucleolar RNA cluster”. Nat. Genet. 40 (6): 719–21. doi:10.1038/ng.158. Retrieved 2014-06-08.
  9. 9.0 9.1 Dmitry A.Samarsky, Maurille J.Fournier, Robert H.Singer and Edouard Bertrand (1 July 1998). “The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization” (PDF). The European Molecular Biology Organization (EMBO) Journal. 17 (13): 3747–3757. doi:10.1093/emboj/17.13.3747. PMID 9649444. Retrieved 2017-02-04.
  10. Yoshinori Tanaka, Hitoshi Kurumizaka, and Shigeyuki Yokoyama (January 2005). “CpG methylation of the CENP-B box reduces human CENP-B binding”. The FEBS Journal. 272 (1): 282–289. doi:10.1111/j.1432-1033.2004.04406.x. PMID 15634350. Retrieved 2017-02-05.
  11. 11.0 11.1 Tianbao Yang and B. W. Poovaiah (22 November 2002). “A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants”. Journal of Biological Chemistry. 277 (47): 45049–45058. doi:10.1074/jbc.M207941200. Retrieved 2017-02-05.
  12. Jonathan J. H. Pearce, Prim B. Singh and Stephen J. Gaunt (1 April 1992). “The mouse has a Polycomb-like chromobox gene” (PDF). Development. 114 (4): 921–9. PMID 1352241. Retrieved 2013-06-15.
  13. NCBI (9 June 2013). CBX5 chromobox homolog 5 [ Homo sapiens (human) ]. U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2013-06-15.
  14. Jian-Quan Chen, Yi Dong, Yu-Jun Wang, Qiang Liu, Jin-Song Zhang, Shou-Yi Chen (October 2003). “An AP2/EREBP-type transcription-factor gene from rice is cold-inducible and encodes a nuclear-localized protein”. Theoretical and Applied Genetics. 107 (6): 972–979. doi:10.1007/s00122-003-1346-5. Retrieved 2017-05-30.
  15. 15.0 15.1 Ute Fischer and Wolfgang Dröge-Laser (2004). “Overexpression of NtERF5, a New Member of the Tobacco Ethylene Response Transcription Factor Family Enhances Resistance to Tobacco mosaic virus. Molecular Plant-Microbe Interactions. 17 (10): 1162–1171. doi:10.1094/MPMI.2004.17.10.1162. Retrieved 2017-05-30.
  16. Cornelis Murre and David Baltimore (1992). “The Helix-Loop-Helix Motif: Structure and Function, In: Transcriptional Regulation. 22B. Cold Spring Harbor Laboratory Press: 861–79. doi:10.1101/087969425.22B.861. Retrieved 2017-02-08.
  17. Cornelis Murre, Gretchen Bain, Marc A. van Dijk, Isaac Engel, Beth A. Furnari, Mark E. Massari, James R. Matthews, Melanie W. Quong, Richard R. Rivera, Maarten H. Stuiver (June 1994). “Structure and function of helix-loop-helix proteins”. Biochimica et Biophysica Acta (BBA) – Gene Structure and Expression. 1218 (2): 129–35. Retrieved 2017-02-08.
  18. 18.0 18.1 18.2 18.3 Edward T Kipreos and Michele Pagano (10 November 2000). “The F-box protein family”. Genome Biology. 1 (5): 3002. doi:10.1186/gb-2000-1-5-reviews3002. Retrieved 2017-02-13.
  19. NCBI (9 June 2013). FOXP3 forkhead box P3 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2013-06-15.
  20. 20.0 20.1 20.2 20.3 20.4 20.5 Lucía Escolar, Jose Pérez-Martín, and Víctor de Lorenzo (October 1999). “Opening the Iron Box: Transcriptional Metalloregulation by the Fur Protein”. Journal of Bacteriology. 181 (20): 6223–9. Retrieved 2017-04-04.
  21. 21.0 21.1 21.2 K Oeda, J Salinas, and N H Chua (July 1991). “A tobacco bZip transcription activator (TAF-1) binds to a G-box-like motif conserved in plant genes”. The EMBO Journal. 10 (7): 1793–1802. Retrieved 2017-02-13.
  22. Timofey S. Rozhdestvensky, Thean Hock Tang, Inna V. Tchirkova, Jürgen Brosius, Jean‐Pierre Bachellerie and Alexander Hüttenhofer (2003). “Binding of L7Ae protein to the K‐turn of archaeal snoRNAs: a shared RNA binding motif for C/D and H/ACA box snoRNAs in Archaea”. Nucleic Acids Research. 31 (3): 869–77. doi:10.1093/nar/gkg175. Retrieved 2014-06-08.
  23. Gregory P. Copenhaver, Christopher D. Putnam, Michael L. Denton and Craig S. Pikaard (1994). “The RNA polymerase I transcription factor UBF is a sequence-tolerant HMG-box protein that can recognize structured nucleic acids” (PDF). Nucleic Acids Research. 22 (13): 2651–7. Retrieved 2017-04-05.
  24. Vincent Laudet, Dominique Stehelin and Hans Clevers (1993). “Ancestry and diversity of the HMG box superfamily” (PDF). Nucleic Acids Research. 21 (10): 2493–501. Retrieved 2017-04-05.
  25. Tomas Valenta, Jan Lukas, Vladimir Korinek (2003). “HMG box transcription factor TCF‐4’s interaction with CtBP1 controls the expression of the Wnt target Axin2/Conductin in human embryonic kidney cells”. Nucleic Acids Research. 31 (9): 2369–80. doi:10.1093/nar/gkg346. Retrieved 2017-04-05.
  26. Akiro Higashikawa, Taku Saito, Toshiyuki Ikeda, Satoru Kamekura, Naohiro Kawamura, Akinori Kan, Yasushi Oshima, Shinsuke Ohba, Naoshi Ogata, Katsushi Takeshita, Kozo Nakamura, Ung-Il Chung, Hiroshi Kawaguchi (January 2009). “Identification of the core element responsive to runt-related transcription factor 2 in the promoter of human type x collagen gene”. Arthritis & Rheumatism. 60 (1): 166–78. doi:10.1002/art.24243. PMID 19116917. Retrieved 2013-06-18.
  27. 27.0 27.1 Günter Theißen, Jan T. Kim, Heinz Saedler (1 November 1996). “Classification and phylogeny of the MADS-box multigene family suggest defined roles of MADS-box gene subfamilies in the morphological evolution of eukaryotes”. Journal of Molecular Evolution. 43 (5): 484–516. doi:10.1007/BF02337521. Retrieved 2015-03-31.
  28. 28.0 28.1 28.2 28.3 Peter Huijser, Joachim Klein, Wolf-Ekkehard Lonnig, Hans Meijer, Heinz Saedler and Hans Sommer (April 1992). “Bracteomania,an inflorescence anomaly,is caused by the loss of function of the MADS-box gene squamosa in Antirrhinum majus (PDF). The EMBO Journal. 11 (4): 1239–49. PMID 556572. Retrieved 2015-04-01.
  29. 29.0 29.1 Wangjie Yu and Paul E. Hardin (2006). “Circadian oscillators of Drosophila and mammals”. Journal of Cell Science. 119: 4793–5. doi:10.1242/jcs.03174. Retrieved 2017-02-19.
  30. Alan C. Christensen & Elton T. Young (23 September 1982). “T4 late transcripts are initiated near a conserved DNA sequence”. Nature. 299 (5881): 369–71. doi:10.1038/299369a0. Retrieved 2017-02-19.
  31. Herman A. de Boer, Lisa J. Comstock, and Mark Vasser (January 1983). “The tac promoter: A functional hybrid derived from the trpand lac promoters” (PDF). Proceedings of the National Academy of Sciences USA. 80 (1): 21–5. Retrieved 2017-02-19.
  32. 32.0 32.1 Montaña Mena, Jesus Vicente-Carbajosa, Robert J. Schmidt and Pilar Carbonero (October 1998). “An endosperm-specific DOF protein from barley, highly conserved in wheat, binds to and activates transcription from the prolamin-box of a native B-hordein promoter in barley endosperm”. The Plant Journal. 16 (1): 53–62. doi:10.1046/j.1365-313x.1998.00275.x. Retrieved 2017-02-19.
  33. 33.0 33.1 33.2 Montaña Mena, Francisco Javier Cejudo, Ines Isabel-Lamoneda and Pilar Carbonero (1 September 2002). “A Role for the DOF Transcription Factor BPBF in the Regulation of Gibberellin-Responsive Genes in Barley Aleurone”. Plant Physiology. 130 (1): 111–9. doi:10.​1104/​pp.​005561 Check |doi= value (help). Retrieved 2017-02-19. zero width space character in |doi= at position 4 (help)
  34. Claudio W. Pikielny, John L. Teem, Michael Rosbash (September 1983). “Evidence for the biochemical role of an internal sequence in yeast nuclear mRNA introns: implications for U1 RNA and metazoan mRNA splicing” (PDF). Cell. 34 (2): 395–403. doi:10.1016/0092-8674(83)90373-2. Retrieved 2017-04-05.
  35. Francisco Rivero (June 2002). “mRNA processing in Dictyostelium: sequence requirements for termination and splicing” (PDF). Protist. 153 (2): 169–76. doi:10.1078/1434-4610-00095. Retrieved 2017-04-05.
  36. 36.0 36.1 NCBI (9 June 2013). TBX2 T-box 2 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2013-06-15.
  37. Lifton RP, Goldberg ML, Karp RW, Hogness DS (1978). “The organization of the histone genes in Drosophila melanogaster: functional and evolutionary implications”. Cold Spring Harb Symp Quant Biol. 42: 1047–51. PMID 98262.
  38. Stephen T. Smale and James T. Kadonaga (July 2003). “The RNA Polymerase II Core Promoter”. Annual Review of Biochemistry. 72 (1): 449–79. doi:10.1146/annurev.biochem.72.121801.161520. PMID 12651739. Retrieved 2012-05-07. Unknown parameter |pdf= ignored (help)
  39. C Yang, E Bolotin, T Jiang, FM Sladek, E Martinez (March 2007). “Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters”. Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMC 1955227. PMID 17123746.
  40. 40.0 40.1 Shigetsugu Hatakeyama, Masayoshi Yada, Masaki Matsumoto, Noriko Ishida and Kei-Ichi Nakayama (31 August 2001). “U Box Proteins as a New Family of Ubiquitin-Protein Ligases”. The Journal of Biological Chemistry. 276: 33111–20. doi:10.1074/jbc.M102755200. Retrieved 2014-06-16.
  41. 41.0 41.1 L. Aravind and Eugene V. Koonin (2000). “The U box is a modified RING finger — a common domain in ubiquitination”. Current Biology. 10 (4): R132–4. |access-date= requires |url= (help)
  42. 42.0 42.1 XIAN-YANG ZHANG, NABILA JABRANE-FERRAT, CLEMENT K. ASIEDU, SANJA SAMAC, B. MATIJA PETERLIN, AND MELANIE EHRLICH (November 1993). “The Major Histocompatibility Complex Class II Promoter-Binding Protein RFX (NF-X) Is a Methylated DNA-Binding Protein” (PDF). MOLECULAR AND CELLULAR BIOLOGY. 13 (11): 6810–8. Retrieved 2017-04-05.
  43. Koji Koike, Takeshi Uchiumi, Takefumi Ohga, Satoshi Toh, Morimasa Wada, Kimitoshi Kohno, and Michihiko Kuwano (17 November 1997). “Nuclear translocation of the Y-box binding protein by ultraviolet irradiation”. FEBS Letters. 417 (3): 390–4. doi:10.1016/S0014-5793(97)01296-9. Retrieved 2017-04-05.

Template:Sisterlinks

© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH