C and D box gene transcription laboratory
Editor-In-Chief: Henry A. Hoff
{{fairuse}}A laboratory is a specialized activity, a construct, you create where you as a student, teacher, or researcher can have hands-on, or as close to hands-on as possible, experience actively analyzing an entity, source, or object of interest. Usually, there’s more to do than just analyzing. The construct is often a room, building or institution equipped for scientific research, experimentation as well as analysis.
This instance is a continuation of the previous laboratory. In the room next door is an astronaut that is on the Mars expedition, three months along on the six months to Mars. A physician and lab assistants have been performing tests on her. Because she has been in zero gravity for more than three months her body chemistry and anatomy now differ from what it was in the controlled gravity environment of Earth. She has lost about 10 % each of her bone, muscle, and brain mass. Comparisons with gene expression sequences now and when on Earth have found that the gene expression for alpha-1-B glycoprotein is not normal. If a way to correct this expression cannot be found she must be returned to Earth maybe to recover, maybe not!
But, it is unlikely she will survive three more months at zero g either to be returned to Earth or put on Mars. Worse, the microgravity may not be the only culprit. There is also the radiation of the interplanetary medium.
You have been tasked to examine her DNA for the effects of the C and D boxes regarding the expression of alpha-1-B glycoprotein.
The C and D boxes are gene transcription factor (TF).
C and D boxes
{{free media}}Many small nucleolar RNAs fall into the family of C/D box snoRNAs.
For “box C/D snoRNAs, boxes C and D and an adjoining stem form a vital structure, known as the box C/D motif.”[1]
“The [C and D] box elements are essential for snoRNA production [transcription] and for snoRNA-directed modification of rRNA nucleotides.”[1]
The “motif is necessary and sufficient for nucleolar targeting, both in yeast and mammals. Moreover, in mammalian cells, RNA is targeted to coiled bodies as well. Thus, the box C/D motif is the first intranuclear RNA trafficking signal identified for an RNA family. Remarkably, it also couples snoRNA localization with synthesis and, most likely, function. The distribution of snoRNA precursors in mammalian cells suggests that this coupling is provided by a specific protein(s) which binds the box C/D motif during or rapidly after snoRNA transcription.”[1]
In snoRNA U73 on the right, the C box starting from the left side of the stem consists of nucleotides: ARUGAUGA, and from the right side the D box is AGUCY. In 5′ to 3′ direction, the D box is YCUGA.
For transcription, U (in RNA) is T, Y=(C or T) and R=(A or G).
Consensus sequences
Shown in the image at the top right are the C box (3′-AGUAGU-5′) and the D box (3′-AGUCUG-5′). Substituting T for U yields C box = 3′-AGTAGT-5′ and D box = 3′-AGTCTG-5′ in the transcription direction on the template strand.
“Members of the box C/D snoRNA family, which are the subject of the present report, possess characteristic sequence elements known as box C (UGAUGA) and box D (GUCUGA).”[1]
Nucleotides
DNA mapping has been performed. Her DNA for A1BG promoters can be found at Gene_transcriptions/A1BG#Nucleotides.
Programming
Sample programs for preparing test programs are available at Gene transcriptions/A1BG/Programming.
Hypotheses
- C and D boxes are not involved in the transcription of A1BG.
- If involved they assist transcription by other TFs.
- C and D boxes occur only in the proximal promoter.
Core promoters

The core promoter is approximately -34 nts upstream from the TSS.
From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.
To extend the analysis from inside and just on the other side of ZNF497 some 3340 nts have been added to the data. This would place the core promoter some 3340 nts further away from the other side of ZNF497. The TSS would be at about 4300 nts with the core promoter starting at 4266.
Def. “the factors, including RNA polymerase II itself, that are minimally essential for transcription in vitro from an isolated core promoter” is called the basal machinery, or basal transcription machinery.[3]
Proximal promoters
Def. a “promoter region [juxtaposed to the core promoter that] binds transcription factors that modify the affinity of the core promoter for RNA polymerase.[12][13]“[4] is called a proximal promoter.
The proximal sequence upstream of the gene that tends to contain primary regulatory elements is a proximal promoter.
It is approximately 250 base pairs or nucleotides, nts, upstream of the transcription start site.
The proximal promoter begins about nucleotide number 4210 in the negative direction.
The proximal promoter begins about nucleotide number 4195 in the positive direction.
Distal promoters
The “upstream regions of the human [cytochrome P450 family 11 subfamily A] CYP11A and bovine CYP11B genes [have] a distal promoter in each gene. The distal promoters are located at −1.8 to −1.5 kb in the upstream region of the CYP11A gene and −1.5 to −1.1 kb in the upstream region of the CYP11B gene.”[5]
“Using cloned chicken βA-globin genes, either individually or within the natural chromosomal locus, enhancer-dependent transcription is achieved in vitro at a distance of 2 kb with developmentally staged erythroid extracts. This occurs by promoter derepression and is critically dependent upon DNA topology. In the presence of the enhancer, genes must exist in a supercoiled conformation to be actively transcribed, whereas relaxed or linear templates are inactive. Distal protein–protein interactions in vitro may be favored on supercoiled DNA because of topological constraints.”[6]
Distal promoter regions may be a relatively small number of nucleotides, fairly close to the TSS such as (-253 to -54)[7] or several regions of different lengths, many nucleotides away, such as (-2732 to -2600) and (-2830 to -2800).[8]
The “[d]istal promoter is not a spacer element.”[9]
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460.
Any transcription factor before A1BG from the direction of ZN497 may be out to 2300 nts.
Samplings
Regarding hypothesis 1
The C and D boxes are not involved in the transcription of A1BG.
For the Basic programs (starting with SuccessablesCbox.bas or SuccessablesDbox.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
- negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesCbox–.bas, looking for 3′-AGTAGT-5′, 4, 3′-AGTAGT-5′, 2888, 3′-AGTAGT-5′, 2944, 3′-AGTAGT-5′, 3418, 3′-AGTAGT-5′, 3521,
- negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesCbox-+.bas, looking for 3′-AGTAGT-5′, 0,
- positive strand in the negative direction is SuccessablesCbox+-.bas, looking for 3′-AGTAGT-5′, 0,
- positive strand in the positive direction is SuccessablesCbox++.bas, looking for 3′-AGTAGT-5′, 1, 3′-AGTAGT-5′, 3251,
- complement, negative strand, negative direction is SuccessablesCboxc–.bas, looking for 3′-TCATCA-5′, 0,
- complement, negative strand, positive direction is SuccessablesCboxc-+.bas, looking for 3′-TCATCA-5′, 1, 3′-TCATCA-5′, 3251,
- complement, positive strand, negative direction is SuccessablesCboxc+-.bas, looking for 3′-TCATCA-5′, 4, 3′-TCATCA-5′, 2888, 3′-TCATCA-5′, 2944, 3′-TCATCA-5′, 3418, 3′-TCATCA-5′, 3521,
- complement, positive strand, positive direction is SuccessablesCboxc++.bas, looking for 3′-TCATCA-5′, 0,
- inverse complement, negative strand, negative direction is SuccessablesCboxci–.bas, looking for 3′-ACTACT-5′, 3, 3′-ACATCA-5′, 2340, 3′-ACATCA-5′, 2541, 3′-ACATCA-5′, 4124,
- inverse complement, negative strand, positive direction is SuccessablesCboxci-+.bas, looking for 3′-ACTACT-5′, 1, 3′-ACATCA-5′, 4116,
- inverse complement, positive strand, negative direction is SuccessablesCboxci+-.bas, looking for 3′-ACTACT-5′, 3, 3′-ACATCA-5′, 2941, 3′-ACATCA-5′, 3394, 3′-ACATCA-5′, 3415,
- inverse complement, positive strand, positive direction is SuccessablesCboxci++.bas, looking for 3′-ACTACT-5′, 0,
- inverse, negative strand, negative direction, is SuccessablesCboxi–.bas, looking for 3′-TGATGA-5′, 0,
- inverse, negative strand, positive direction, is SuccessablesCboxi-+.bas, looking for 3′-TGATGA-5′, 1, 3′-TGATGA-5′, 2144,
- inverse, positive strand, negative direction, is SuccessablesCboxi+-.bas, looking for 3′-TGATGA-5′, 0,
- inverse, positive strand, positive direction, is SuccessablesCboxi++.bas, looking for 3′-TGATGA-5′, 0.
For the Basic programs (starting with SuccessablesDbox.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
- negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesDbox–.bas, looking for 3′-AGTCTG-5′, 1, 3′-AGTCTG-5′, 2947,
- negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesDbox-+.bas, looking for 3′-AGTCTG-5′, 1, 3′-AGTCTG-5′, 3923,
- positive strand in the negative direction is SuccessablesDbox+-.bas, looking for 3′-AGTCTG-5′, 1, 3′-AGTCTG-5′, 1355,
- positive strand in the positive direction is SuccessablesDbox++.bas, looking for 3′-AGTCTG-5′, 0,
- complement, negative strand, negative direction is SuccessablesDboxc–.bas, looking for 3′-TCAGAC-5′, 1, 3′-TCAGAC-5′, 1355,
- complement, negative strand, positive direction is SuccessablesDboxc-+.bas, looking for 3′-TCAGAC-5′, 0,
- complement, positive strand, negative direction is SuccessablesDboxc+-.bas, looking for 3′-TCAGAC-5′, 1, 3′-TCAGAC-5′, 2947,
- complement, positive strand, positive direction is SuccessablesDboxc++.bas, looking for 3′-TCAGAC-5′, 1, 3′-TCAGAC-5′, 3923,
- inverse complement, negative strand, negative direction is SuccessablesDboxci–.bas, looking for 3′-CAGACT-5′, 0,
- inverse complement, negative strand, positive direction is SuccessablesDboxci-+.bas, looking for 3′-CAGACT-5′, 2, 3′-CAGACT-5′, 1744, 3′-CAGACT-5′, 2416,
- inverse complement, positive strand, negative direction is SuccessablesDboxci+-.bas, looking for 3′-CAGACT-5′, 2, 3′-CAGACT-5′, 15, 3′-CAGACT-5′, 1616,
- inverse complement, positive strand, positive direction is SuccessablesDboxci++.bas, looking for 3′-CAGACT-5′, 3, 3′-CAGACT-5′, 2943, 3′-CAGACT-5′, 3006, 3′-CAGACT-5′, 3924,
- inverse, negative strand, negative direction, is SuccessablesDboxi–.bas, looking for 3′-GTCTGA-5′, 2, 3′-GTCTGA-5′, 15, 3′-GTCTGA-5′, 1616,
- inverse, negative strand, positive direction, is SuccessablesDboxi-+.bas, looking for 3′-GTCTGA-5′, 3, 3′-GTCTGA-5′, 2943, 3′-GTCTGA-5′, 3006, 3′-GTCTGA-5′, 3924,
- inverse, positive strand, negative direction, is SuccessablesDboxi+-.bas, looking for 3′-GTCTGA-5′, 0,
- inverse, positive strand, positive direction, is SuccessablesDboxi++.bas, looking for 3′-GTCTGA-5′, 2, 3′-GTCTGA-5′, 1744, 3′-GTCTGA-5′, 2416.
Regarding hypothesis 2
If involved they assist transcription by other TFs.
A Google scholar search using key words: “C box”, “D box”, and A1BG produced zero results.
Regarding hypothesis 3
C and D boxes occur only in the proximal promoter.
GeneID: 60674 GAS5 growth arrest specific 5 (non-protein coding). “This gene produces a spliced long non-coding RNA and is a member of the 5′ terminal oligo-pyrimidine class of genes. It is a small nucleolar RNA host gene, containing multiple C/D box snoRNA genes in its introns. Part of the secondary RNA structure of the encoded transcript mimics glucocorticoid response element (GRE) which means it can bind to the DNA binding domain of the glucocorticoid receptor (nuclear receptor subfamily 3, group C, member 1). This action blocks the glucocorticoid receptor from being activated and thereby stops it from regulating the transcription of its target genes. This transcript is also thought to regulate the transcriptional activity of other receptors, such as androgen, progesterone and mineralocorticoid receptors, that can bind to its GRE mimic region. Multiple functions have been associated with this transcript, including cellular growth arrest and apoptosis. It has also been identified as a potential tumor suppressor, with its down-regulation associated with cancer in multiple different tissues.”[10]
“The antisense elements located immediately upstream of the D box and/or the D′ box match the sequence of the target RNA, while the areas immediately upstream of the C box and immediately downstream of the D box form a 5′–3′ terminal stem”.[11]
“Small nucleolar RNAs (snoRNAs) are noncoding RNAs involved in the processing and modification of ribosomal RNAs. They are grouped in two distinct families, the box C/D family, which catalyzes methylation of 2′-hydroxyls of the pre-rRNA precursor, and the box H/ACA family, which catalyzes the modification of uridines into pseudouridines in various RNAs (reviewed in Refs. [24] and [40]).”[12]
“Small nucleolar RNAs (snoRNAs) are 60–300-nucleotide-long RNAs located in the nucleolus or in Cajal bodies. They constitute one of the most abundant classes of ncRNAs [9]. Predominantly intronic, 300 different snoRNA sequences are located in the human genome. They are classified into two categories, those containing boxes C and D; and, those containing boxes H and ACA. snoRNAs are generated after splicing, debranching, and trimming of mRNA introns. Subsequently, mature snoRNAs associate with proteins to form small nucleolar ribonucleoproteins (snoRNPs). These complexes are exported into the nucleolus to participate in rRNA processing [5].”[13]
Tiny “RNAs with a modal length of 18 nt […] map within -60 to +120 nt of transcription start sites (TSSs) in human, chicken and Drosophila. These transcription initiation RNAs (tiRNAs) are derived from sequences on the same strand as the TSS and are preferentially associated with G+C-rich promoters. The 5′ ends of tiRNAs show peak density 10-30 nt downstream of TSSs, indicating that they are processed. tiRNAs are generally, although not exclusively, associated with highly expressed transcripts and sites of RNA polymerase II binding.”[14]
“With exception of U3 all box C/D snoRNAs presented in this study are intron-encoded, as it is the general pathway for the biogenesis of this class of snoRNAs (22).”[15]
“Box C/D snoRNAs […] contain conserved Box C (UGAUGA) and Box D (CUGA) elements located closely to the 5′- and 3′-ends, respectively. Internal copies of these elements are termed Box C′ and Box D′ (20,21).”[15]
Verifications
To verify that your sampling has explored something, you may need a control group. Perhaps where, when, or without your entity, source, or object may serve.
Another verifier is reproducibility. Can you replicate something about your entity in your laboratory more than 3 times. Five times is usually a beginning number to provide statistics (data) about it.
For an apparent one time or perception event, document or record as much information coincident as possible. Was there a butterfly nearby?
Has anyone else perceived the entity and recorded something about it?
Gene ID: 1, includes the nucleotides between neighboring genes and A1BG. These nucleotides can be loaded into files from either gene toward A1BG, and from template and coding strands. These nucleotide sequences can be found in A1BG gene transcriptions. Copying the above discovered HNF6s and putting the sequences in “⌘F” locates these sequences in the same nucleotide positions as found by the computer programs.
Core promoters C boxes or D boxes
From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.
There are no C boxes or D boxes in the core promoter from approximately 4425 to the possible transcription start site at nucleotide number 4460.
From the first nucleotide just after ZNF497 to the first nucleotide just before A1BG are 858 nucleotides. The core promoter on this side of A1BG extends from approximately 824 to the possible transcription start site at nucleotide number 858. Nucleotides (nts) have been added from ZNF497 to A1BG. The TSS for A1BG is now at 4300 nts from just on the other side of ZNF497. The core promoter should now be from 4266 to 4300.
There are no C boxes or D boxes in the core promoter from approximately 4266 to the possible transcription start site at nucleotide number 4300.
Proximal promoter C boxes or D boxes
The proximal promoter begins about nucleotide number 4210 in the negative direction.
There are no C boxes or D boxes in the proximal promoter beginning about nucleotide number 4210 in the negative direction.
The proximal promoter begins about nucleotide number 4050 in the positive direction.
There is one C box 3′-ACATCA-5′ at 4116 but no D boxes in the proximal promoter beginning about nucleotide number 4050 in the positive direction.
Distal promoter C and D boxes
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460 in the negative direction.
There are four C boxes in the distal promoter: 3′-AGTAGT-5′ at 2888, 3′-AGTAGT-5′ at 2944, 3′-AGTAGT-5′ at 3418, and 3′-AGTAGT-5′ at 3521 on the negative strand in the negative direction and its complement on the positive strand.
There is one D box in the distal promoter: 3′-AGTCTG-5′ at 2947 on the negative strand in the negative direction and its complement on the positive strand.
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2300 in the positive direction.
There is one C box in the distal promoter: 3′-TCATCA-5′ at 3251 on the negative strand in the positive direction and its complement on the positive strand.
There is one D box in the distal promoter: 3′-AGTCTG-5′ at 3923 on the negative strand in the positive direction and its complement on the positive strand.
Transcribed C and D boxes
“Small nucleolar RNAs (snoRNAs) are 60–300-nucleotide-long RNAs located in the nucleolus or in Cajal bodies. They constitute one of the most abundant classes of ncRNAs [9]. Predominantly intronic, 300 different snoRNA sequences are located in the human genome. They are classified into two categories, those containing boxes C and D; and, those containing boxes H and ACA. snoRNAs are generated after splicing, debranching, and trimming of mRNA introns. Subsequently, mature snoRNAs associate with proteins to form small nucleolar ribonucleoproteins (snoRNPs). These complexes are exported into the nucleolus to participate in rRNA processing [5].”[13]
Tiny “RNAs with a modal length of 18 nt […] map within -60 to +120 nt of transcription start sites (TSSs) in human, chicken and Drosophila. These transcription initiation RNAs (tiRNAs) are derived from sequences on the same strand as the TSS and are preferentially associated with G+C-rich promoters. The 5′ ends of tiRNAs show peak density 10-30 nt downstream of TSSs, indicating that they are processed. tiRNAs are generally, although not exclusively, associated with highly expressed transcripts and sites of RNA polymerase II binding.”[14]
“With exception of U3 all box C/D snoRNAs presented in this study are intron-encoded, as it is the general pathway for the biogenesis of this class of snoRNAs (22).”[15]
Five “principal motif-based classes of D. melanogaster promoters were proposed15, which could be further grouped into three general functional classes16.”[16]
“Type I consists of the tissue-specific promoters, which are similar to the low-CpG class in mammals with respect to motif composition, stage of development at which they are expressed and tissue specificity, and they are characterized by a high enrichment for a TATA box at an appropriate distance from an initiator element (Inr element). Type II promoters are associated with ‘housekeeping’ genes and genes that are regulated at the level of individual cells; they have either a DNA recognition element (DRE) or a combination of novel motifs15. Finally, type III promoters have an Inr element only or an Inr element plus a downstream promoter element (DPE). These promoters are preferentially associated with developmentally regulated genes, the expression of which is precisely coordinated across different cells in a tissue or anatomical structure16.”[16]
Laboratory reports
Below is an outline for sections of a report, paper, manuscript, log book entry, or lab book entry. You may create your own, of course.
C and D box transcription laboratory
by —Marshallsumter (discuss • contribs) 19:41, 22 May 2018 (UTC)
Abstract
Three hypotheses have been examined: (1) the C and D boxes if present are not involved in the transcription of A1BG, (2) if involved they assist transcription by other TFs, and (3) C and D boxes occur only in the proximal promoter. These have been tested by literature searching articles using key words: “C box”, “D box”, and A1BG and searching the National Center for Biotechnology Information (NCBI) Gene database using (C/D box human) AND “Homo sapiens”[porgn:__txid9606]. Where applicable they have been tested using computer programs to search NCBI nucleotide records on either side of A1BG DNA. Both the template DNA strand and the coding strand have been checked. To attempt to show that these two boxes can be used during or for transcription of A1BG at least one transcription factor has been searched for.
Introduction
According to one source, A1BG is transcribed from the direction of ZNF497: 3′ – 58864890: CGAGCCACCCCACCGCCCTCCCTTGG+1GGCCTCATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCGACCATCATG : 58866601-5′, per Michael David Winther, Leah Christine Knickle, Martin Haardt, Stephen John Allen, Andre Ponton, Roberto Justo De Antueno, Kenneth Jenkins, Solomon O. Nwaka, and Y. Paul Goldberg, Fat Regulated Genes, Uses Thereof and Compounds for Mudulating Same, US Patent Office, July 29, 2004, at http://www.google.com/patents?hl=en&lr=&vid=USPATAPP10416914&id=7iaVAAAAEBAJ&oi=fnd&printsec=abstract#v=onepage&q&f=false where the second ‘G’ at left of four Gs in a row is the TSS. Transcription was triggered in cell cultures and the transcription start site was found using reverse transcriptase. But, the mechanism for transcription is unknown.
Controlling the transcription of A1BG may have significant immune function against snake envenomation. A1BG forms a complex that is similar to those formed between toxins from snake venom and A1BG-like plasma proteins. These inhibit the toxic effect of snake venom metalloproteinases or myotoxins and protect the animal from envenomation.[17]
TATA boxes
A1BG does not have a TATA box in the two core promoter regions.
Initiator elements
A1BG does not have Inrs at either apparent TSS.
Downstream Promoter Elements
Several DPEs occur at or very close to their necessary locations relative to the TSSs on both sides.
Transcription factors
Many transcription factors (TFs) may occur upstream and occasionally downstream of the transcription start site (TSS), in this gene’s promoter. The following have been examined so far: (1) AGC boxes (GCC boxes), (2) ATA boxes, (3) CArG boxes, (4) enhancer boxes, (5) HY boxes, (6) metal responsive elements (MREs), (7) STAT5s, and (8) HNF6s.
AGC boxes (GCC boxes)
An AGC box was found in the distal promoter of either gene ZSCAN22 or A1BG on both the template and coding strands. But, as the only known transcription of A1BG occurs between Gene ID: 162968 ZNF497 and Gene ID: 1 A1BG, it is unlikely that this AGC box is naturally used to transcribe A1BG.
A full web search produced several references including a GeneCard[18] for “zinc finger protein 497” and “GCC box”, including “May be involved in transcriptional regulation.”[18] Zinc fingers are mentioned in association with GCC boxes in plants. It seems unlikely that an AGC box is involved in any way with the transcription of A1BG.
An extension of the nucleotide data for the positive direction from ZNF475 toward A1BG from 958 nts to 4445 nts has not discovered any AGC boxes even in the distal promoter just beyond ZNF497.
ATA boxes
Regarding hypothesis 1: there are no ATA boxes in the core promoter of A1BG from either direction or strand. This hypothesis has been shown to be true. A corollary hypothesis might be 1.1: there are no ATA boxes in the proximal promoter of A1BG from either direction or strand. This corollary hypothesis may be true. “The analysis of the promoter region indicated that a putative ATA box is located 54 nucleotides upstream from the transcription start site”.[19] There is one inverse and inverse complement ATA box in the proximal promoter in the positive direction between 4050 and 4300: 3′-AAATAA-5′ at 4142, and 3′-TTTATT-5′ at 4142. As the TSS is at 4300 nts, this ATA box is some 158 nts away, where with the smaller data set 3′-TTTATT-5′ was at 703. As the TSS is at 858 nts, this ATA box is some 155 nts away, which is approximately the same number of nts from the TSS but not close enough to be in the core promoter and not 54 nts upstream from the TSS or to match other such genes with an ATA box.
But the ATA box at 2347 is likely involved in transcription of A1BG in analogy to the rat. Although this has not been confirmed as involved, the existence of this ATA box likely proves hypothesis 1 false.
Regarding hypothesis 2: ATA boxes have a role as downstream signal transducers in A1BG. There is the following inverse ATA box on the negative strand, negative direction: 3′-AAATAA-5′ at 4537. On this strand, in this direction the TSS is at 4460 nts from ZSCAN22. This ATA box is 77 nts downstream. So far no published research has been found to verify this type of downstream promoter or enhancer ATA box. There may be another isoform TSS nearby. As such, hypothesis 2 may be true.
Regarding hypothesis 3: ATA boxes may assist transcription of A1BG by other transcription factors. This hypothesis has been shown by literature search to be true. But, none of the ATA boxes for A1BG are close enough to any STAT5 promoter to match known transcription initiation.
CArG boxes
By combining a literature search with computer analysis of each promoter between ZSCAN22 and A1BG and ZNF497 and A1BG, CArG boxes have been found. To show that these CArG boxes may be used during or for transcription of A1BG at least one transcription factor has been affirmed.
A literature search of more recent results discovered: “Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [. Three] other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins.”[20]
These together with the core motif CC(A/T)6GG suggest a more general CArG-box motif of (C(C/A/T)(A/T)6(A/G)G). Subsequent computer-program testing revealed two more general CArG boxes: 3′-CAAAAAAAAG-5′ at 1399 nts from ZSCAN22 and 3′-CATTAAAAGG-5′ at 3441 nts from ZSCAN22, but none within 4300 nts toward A1BG from ZNF497.
These results show that the presence of CArG boxes on the ZSCAN22 side of A1BG implies their use when transcribing A1BG, although they may be pointing toward ZSCAN22. These suggest that the hypothesis (A1BG is not transcribed by a CArG box) is false. Regarding the second hypothesis (The lack of a CArG box on either side of A1BG does not prove that it is not actively used to transcribe A1BG), the presence of more general CArG boxes in the distal promoter tentatively confirms this hypothesis.
CArG boxes do occur in the distal promoter of A1BG on the ZSCAN22 side only. And, it is likely that a CArG box is involved in some way with the transcription of A1BG.
Enhancer boxes
The presence of many enhancer boxes on both sides of A1BG demonstrate that the hypothesis: “A1BG is not transcribed by an enhancer box”, is false.
The finding by literature search of evidence verifying that at least one transcription factor can enhance or inhibit the transcription of A1BG using one or more enhancer boxes disproves the hypothesis: “Existence of an enhancer box on either side of A1BG does not prove that it is actively used to transcribe A1BG”.
Enhancer boxes do occur in the proximal and distal promoters of A1BG. And, it is likely that an enhancer box is involved in some way with the transcription of A1BG.
HY boxes
HY boxes were not found in either core promoters or the proximal promoters in either direction. However, HY boxes were found in the distal promoters on both sides of A1BG. No genes are described in the literature so far as transcribed from HY boxes in any distal promoters.
Either A1BG can be transcribed by HY boxes in the distal promoter, or A1BG is not transcribed by HY boxes. As the literature appears absent from a Google Scholar advanced search to confirm possible transcription from distal promoters, wet chemistry experiments are needed to test the possibility.
Metal responsive elements
By combining a literature search with computer analysis of the promoter between ZSCAN22 and A1BG and ZNF497 and A1BG, metal responsive elements have been found. Literature search has also discovered at least three post-translational isoforms including the unaltered precursor. Although no metal responsive elements overlap any enhancer boxes in the distal promoter, there are elements in the distal promoter.
“The human genome is estimated to contain 700 zinc-finger genes, which perform many key functions, including regulating transcription. [Four] clusters of zinc-finger genes [occur] on human chromosome 19”.[21]
Nearby zinc-fingers on chromosome 19 include ZNF497 (GeneID: 162968), ZNF837 (GeneID: 116412), and ZNF8 (GeneID: 7554).
“In rodents and in humans, about one third of the zinc-finger genes carry the Krüppel-associated box (KRAB), a potent repressor of transcription (Margolin et al. 1994), […]. There are more than 200 KRAB-containing zinc-finger genes in the human genome, about 40% of which reside on chromosome 19 and show a clustered organization suggesting an evolutionary history of duplication events (Dehal et al. 2001).”[21]
ZNF8 is in cluster V along with A1BG.[21]
“In contrast to the four clusters considered [I through IV], one that occurs at the telomere of chromosome 19, which we will call cluster V, has been very stable [over mouse, rat, and human].”[21]
“Apart from the somewhat unexpected location of Zfp35 on mouse chromosome 18 and of the AIBG orthologs on mouse chromosome 15 and rat chromosome 7, there has been little rearrangement.”[21]
So far no article has reported any linkage between zinc, including various zinc fingers, or cadmium, and A1BG.
Regarding additional isoforms, mention has been made of “new genetic variants of A1BG.”[22]
“Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein (A1BG) and its post-translationally modified isoforms.”[23]
Pharmacogenomic variants have been reported. There are A1BG genotypes.[24]
A1BG has a genetic risk score of rs893184.[24]
“A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10−5).”[24]
“rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG.”[24]
For example, GeneID: 9 has isoforms: a, b, X1, and X2. Each of these (a and b) have variants. Variants 1-6 and 9 all encode the same isoform (a).
Variants 7, 8 and 10 all encode isoform b. Isoforms X1 and X2 are predicted.
Variants can differ in promoters, untranslated regions, or exons. For GeneID: 9: This variant (1) represents the longest transcript but encodes the shorter isoform (a). This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter.
This variant (2, also known as Type IID) lacks an alternate exon in the 5′ UTR, compared to variant 1. This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter.
This variant (9, also known as Type IA) has a distinct 5′ UTR and represents use of an alternate promoter known as the NATa or P3 promoter, compared to variant 1.
But, A1BG in NCBI Gene lists only one isoform, the gene locus itself, and the protein transcribed is a precursor subject to translational or more likely post-translational modifications.
The presence of multiple MREs coupled with experimental results from the literature indicating post-translational isoforms tends to confirm the existence of two or more isoforms for A1BG.
It isn’t known which, if any, assist in locating and affixing the transcription mechanism for A1BG. This examination is the first to test one such DNA-occurring TF: the HNF6s.
The presence of multiple MREs coupled with experimental results from the literature indicating post-translational isoforms tends to confirm the existence of two or more isoforms for A1BG and likely transcription from either side.
STAT5s
STAT5s have a role as downstream signal transducers in A1BG, where the murine downstream promoter element is only 11 nts displaced from the human one. This suggests a STAT5 participation in human gene transcription of A1BG in the proximal promoter downstream between any other promoter and the TSS on the ZNF497 side of A1BG.
A1BG is not transcribed by any STAT5s is clearly disproved by the STAT5 transcription factor in the proximal promoter on the ZNF497 side of A1BG.
STAT5s may assist transcription of A1BG by other transcription factors, literature search has found that STAT5s assist transcription of A1BG by other transcription factors.[25] The proximal STAT5 promoter is -58 to -50 from A1BG TSS. If another STAT5 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected.[25] A STAT5 transcription site lies at 3′-TTCCGGGAA-5′ at 4247 in the proximal promoter, i.e. from 4242 (-58) to 4250 (-50). This suggests that STAT5 assists in the transcription of A1BG.
HNF6s
HNF6s may have a downstream proximal promoter element if the computer nts sampling is additionally, approximately at least 250 nts downstream of the transcription start site. “Downstream” can refer to downstream from an enhancer but before the transcription start site, downstream from a TATA box or an initiator element but before the transcription start site (TSS), downstream from another promoter element and containing the TSS, or downstream after the TSS. The computer programs written to test for HNF6 promoters were limited to 100 nts below the apparent TSSs.
There is a HNF6 on the negative strand in the positive direction (from ZNF497 to A1BG) of 3′-TTCCGGGAA-5′ at 808 in the proximal promoter, where the TSS is at 858 nts from ZNF497.
There is no such “downstream” promoter between ZSCAN22 and A1BG.
Both a TATA box or an Inr are within the core promoter. There are no HNF6s within any core promoters per the computer program sampling from ZNF497 or ZSCAN22 and A1BG.
There are no HNF6s within any core promoters per the computer program sampling from ZNF497 or ZSCAN22 and A1BG containing either TSS.
No HNF6s were detected at least to 100 nts downstream of each TSS.
There is a HNF6 on the negative strand in the positive direction (from ZNF497 to A1BG) of 3′-TTCCGGGAA-5′ at 808 in the proximal promoter, where the TSS is at 858 nts from ZNF497. This direction is the only confirmed transcription of A1BG; therefore, it is likely A1BG is transcribed using this HNF6 transcription factor.
There are two HNF6s on the negative strand in the negative direction, 3′-AAGCAACTT-5′ at 3506 and 3′-AAGGGACTT-5′ at 3782. Both of these are in the distal promoter between ZSCAN22 and A1BG.
The only known TSS for A1BG lies at 4300 nts from just beyond ZNF497 toward A1BG. There two HNF6s in the proximal promoter between 4050 and 4300, 3′-TTATTGATTA-5′ at 4164 and 3′-TATAATTGTT-5′ at 4172, i.e. outside from 4242 (-58) to 4250 (-50). This suggests that HNF6 assists in the transcription of A1BG, but not downstream of the TSS.
{{fairuse}}Both “the 2.3 kb and the 160 bp proximal parts of the a1bg promoter direct sex-specific expression of the reporter gene, and that a negative regulatory element resides in the −1 kb to −160 bp region.”[25]
“Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative HNF6 sites and one [hepatic nuclear factor 6] HNF6/HNF3 binding site at −2077/−2069, −69/−61 and −137/−128 respectively […].”[25]
The “GH-dependent sexually dimorphic expression conveyed by the 2.3 kb a1bg promoter is enhanced by the HNF6/HNF3 site […].”[25]
“HNF6 bound to the a1bg HNF6 oligonucleotide, but in this case, the mutated oligonucleotide was able to compete for binding when added in large excess […]. However, […] the HNF6 binding capacity of the mutated oligonucleotide was clearly reduced. A 20 molar excess of the mutated oligonucleotide had only a marginal effect on the binding of HNF6 […], whereas a 20 molar excess of unlabelled probe […] completely abolished binding. Supershift analysis with an HNF6 antibody revealed a complex with a slightly lower mobility than the HNF6 complex […]. By extending the electrophoresis run and including nuclear extract from hypophysectomized rats, devoid of GH and thereby lacking HNF6 (Lahuna et al. 1997), the two different complexes were clearly visualized. The complex with the lower mobility is most probably due to the binding of HNF3, in analogy with what was shown by Lahuna et al. for the CYP2C12 HNF6 binding site; HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997). […] HNF6 could bind to their respective site in the a1bg promoter in vitro, and the mutations introduced in respective site abolished binding of the corresponding factor.”[25]
The “expression of a −116/−89 deletion construct in which also the HNF6 site was mutated, (−116/−89) delmutHNF6-Luc, […] the generated luciferase activities were reduced in both sexes […]. This is in contrast to that mutation/deletion of the sites separately only affected the expression in female livers.”[25]
The “−116/−89 region contains a site(s) of importance for the GH-dependent and female-specific expression of the a1bg gene, and that the impact of this region together with the HNF6 site is more complex than mere enhancement of the expression in females.”[25]
Following “mutation of the HNF6-binding element, mutHNF6-Luc, the sex-differentiated expression was attenuated due to reduced expression in females. Thus, for a1bg, the sex-related difference in amount of HNF6 is likely to contribute to the sex-differentiated and female characteristic expression.”[25]
Nuclear “proteins binding to the a1bg −116/−89 region [are] members of the [nuclear factor 1] NF1 and the [octamer transcription factor] Oct families of transcription factors. NF1 genes are expressed in most adult tissues (Osada et al. 1999). It is not known how NF1 modulates transcriptional activity, and both activation and repression of transcription have been reported (Gronostajski 2000). Cofactors such as CBP/p300 and HDAC have been shown to interact with NF1 proteins suggesting modulation of chromatin structure (Chaudhry et al. 1999). NF1 factors have also been shown to interact directly with the basal transcription machinery as well as with other transcription factors, including Stat5 (Kim & Roeder 1994, Mukhopadhyay et al. 2001) and synergistic effects with HNF4 have been reported (Ulvila et al. 2004). In addition to the HNF6, Stat5 and NF1/Oct sites, the a1bg promoter harbours an imperfect HNF4 site at −51/−39 with two mismatches compared with the HNF4 consensus site. HNF4 is clearly important for the expression of CYP2C12 (Sasaki et al. 1999), however, the −51/−39 region in a1bg was not protected in the footprinting analysis and was therefore not analysed further. Like NF1, Oct proteins have been reported to be involved in activation as well as repression of gene expression (Phillips & Luisi 2000). […] Moreover, NF1 and Oct-1 have been shown to, reciprocally, facilitate each other’s binding (O’Connor & Bernard 1995, Belikov et al. 2004).”[25]
In the diagram on the right is liver “expression of a1bg-luciferase constructs. (A) Stat5 and HNF6 consensus sequences and corresponding sites in the 2.3 kb a1bg promoter alongside with the used mutations. (B) Female (black bars) and male (open bars) rats [results].”[25]
“Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed [a] HNF6 [site] at […] −69/−61 […].”[25]
The murine downstream promoter element is only 11 nts displaced from the human one. This suggests a HNF6 participation in human gene transcription of A1BG.
“Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative HNF6 sites […] at −2077/−2069 [and] −69/−61 […].”[25]
There are two HNF6s on the negative strand in the negative direction, 3′-AAGCAACTT-5′ at 3506 (-954) and 3′-AAGGGACTT-5′ at 3782 (-678) in the distal promoter between ZSCAN22 and A1BG. Although much closer than their likely murine counterparts, they are on the other side of A1BG from the HNF6 site confirming hypothesis 1. If active in humans or murine-like HNF6s occur within or beyond ZNF497 in this distal promoter, then human A1BG is transcribed using HNF6 promoters disproving hypothesis 2.
A Google Scholar search using ZNF497 with HNF6 found no articles discussing HNF6 sites inside or associated with ZNF497. To confirm they exist, a data file going 4300 nts to just beyond ZNF497 has been created and tested for a distal promoter on this side. Distal HNF6s in the positive direction, if they exist, would be inside ZNF497 or beyond, e.g., 3′-ATGTCCATGG-5′ at 3581 was found.
Literature search has found that HNF6s assist transcription of A1BG by other transcription factors.[25] The proximal HNF6 promoter is -58 to -50 from A1BG TSS. If another HNF6 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected.[25]
Per earlier laboratories transcription factors may occur in the distal promoters on the ZNF497 side of A1BG for
- ATA boxes 3′-AATAAA-5′ occurs at 3427,
- CArG boxes,
- Enhancer boxes,
- HY boxes,
- MREs and
- STAT5s 3′-TTCCATGAA-5′ occurs at 128.
The HNF6 promoter on the other side of A1BG (at about +3 kb is way beyond -2.1 through ZNF497 unless the DNA is folded to allow the HNF6 on the ZSCAN22 side to be used in analogy to the HNF6 on the same side as in the rat.[25]
HNF6s have a role as downstream signal transducers in A1BG, where the murine downstream promoter element is only 11 nts displaced from the human one. This suggests a HNF6 participation in human gene transcription of A1BG.
Experiments
Computer programs were written and run on the positive and negative strands between ZSCAN22 or ZNF497 and A1BG.
Regarding hypothesis 1: The C and D boxes are not involved in the transcription of A1BG.
The Basic programs (starting with SuccessablesCbox.bas) were written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+) looking for 16 possible types of promoters.
The Basic programs (starting with SuccessablesDbox.bas) were written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+) looking for 16 possible types of promoters.
Regarding hypothesis 2: If involved they assist transcription by other TFs.
A Google scholar search was performed using key words: “C box”, “D box”, and A1BG.
Regarding hypothesis 3: C and D boxes occur only in the proximal promoter.
An extensive search of the National Center for Biotechnology Information (NCBI) Gene database using (C/D box human) AND “Homo sapiens”[porgn:__txid9606] was performed.
Results
Regarding hypothesis 1: The C and D boxes are not involved in the transcription of A1BG.
There are no C boxes or D boxes in the core promoter from approximately 4425 to the possible transcription start site at nucleotide number 4460.
There are no C boxes or D boxes in the core promoter from approximately 4266 to the possible transcription start site at nucleotide number 4300.
There are no C boxes or D boxes in the proximal promoter beginning about nucleotide number 4210 in the negative direction.
There is one C box 3′-ACATCA-5′ at 4116 but no D boxes in the proximal promoter beginning about nucleotide number 4050 in the positive direction.
There are four C boxes in the distal promoter: 3′-AGTAGT-5′ at 2888, 3′-AGTAGT-5′ at 2944, 3′-AGTAGT-5′ at 3418, and 3′-AGTAGT-5′ at 3521 on the negative strand in the negative direction and its complement on the positive strand.
There is one D box in the distal promoter: 3′-AGTCTG-5′ at 2947 on the negative strand in the negative direction and its complement on the positive strand.
There is one C box in the distal promoter: 3′-TCATCA-5′ at 3251 on the negative strand in the positive direction and its complement on the positive strand.
There is one D box in the distal promoter: 3′-AGTCTG-5′ at 3923 on the negative strand in the positive direction and its complement on the positive strand.
Regarding hypothesis 2: If involved they assist transcription by other TFs.
A Google scholar search using key words: “C box”, “D box”, and A1BG produced zero results.
Regarding hypothesis 3: C and D boxes occur only in the proximal promoter.
Gene ID: 60674 is GAS5 growth arrest specific 5 (non-protein coding). “This gene produces a spliced long non-coding RNA and is a member of the 5′ terminal oligo-pyrimidine class of genes. It is a small nucleolar RNA host gene, containing multiple C/D box snoRNA genes in its introns. Part of the secondary RNA structure of the encoded transcript mimics glucocorticoid response element (GRE) which means it can bind to the DNA binding domain of the glucocorticoid receptor (nuclear receptor subfamily 3, group C, member 1). This action blocks the glucocorticoid receptor from being activated and thereby stops it from regulating the transcription of its target genes. This transcript is also thought to regulate the transcriptional activity of other receptors, such as androgen, progesterone and mineralocorticoid receptors, that can bind to its GRE mimic region. Multiple functions have been associated with this transcript, including cellular growth arrest and apoptosis. It has also been identified as a potential tumor suppressor, with its down-regulation associated with cancer in multiple different tissues.”[10]
“The antisense elements located immediately upstream of the D box and/or the D′ box match the sequence of the target RNA, while the areas immediately upstream of the C box and immediately downstream of the D box form a 5′–3′ terminal stem”.[11]
“Small nucleolar RNAs (snoRNAs) are noncoding RNAs involved in the processing and modification of ribosomal RNAs. They are grouped in two distinct families, the box C/D family, which catalyzes methylation of 2′-hydroxyls of the pre-rRNA precursor, and the box H/ACA family, which catalyzes the modification of uridines into pseudouridines in various RNAs (reviewed in Refs. [24] and [40]).”[12]
“Small nucleolar RNAs (snoRNAs) are 60–300-nucleotide-long RNAs located in the nucleolus or in Cajal bodies. They constitute one of the most abundant classes of ncRNAs [9]. Predominantly intronic, 300 different snoRNA sequences are located in the human genome. They are classified into two categories, those containing boxes C and D; and, those containing boxes H and ACA. snoRNAs are generated after splicing, debranching, and trimming of mRNA introns. Subsequently, mature snoRNAs associate with proteins to form small nucleolar ribonucleoproteins (snoRNPs). These complexes are exported into the nucleolus to participate in rRNA processing [5].”[13]
Tiny “RNAs with a modal length of 18 nt […] map within -60 to +120 nt of transcription start sites (TSSs) in human, chicken and Drosophila. These transcription initiation RNAs (tiRNAs) are derived from sequences on the same strand as the TSS and are preferentially associated with G+C-rich promoters. The 5′ ends of tiRNAs show peak density 10-30 nt downstream of TSSs, indicating that they are processed. tiRNAs are generally, although not exclusively, associated with highly expressed transcripts and sites of RNA polymerase II binding.”[14]
“With exception of U3 all box C/D snoRNAs presented in this study are intron-encoded, as it is the general pathway for the biogenesis of this class of snoRNAs (22).”[15]
“Box C/D snoRNAs […] contain conserved Box C (UGAUGA) and Box D (CUGA) elements located closely to the 5′- and 3′-ends, respectively. Internal copies of these elements are termed Box C′ and Box D′ (20,21).”[15]
Gene ID: 7422 VEGFA vascular endothelial growth factor A. “This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.”[26]
Discussions
“Type I consists of the tissue-specific promoters, which are similar to the low-CpG class in mammals with respect to motif composition, stage of development at which they are expressed and tissue specificity, and they are characterized by a high enrichment for a TATA box at an appropriate distance from an initiator element (Inr element). Type II promoters are associated with ‘housekeeping’ genes and genes that are regulated at the level of individual cells; they have either a DNA recognition element (DRE) or a combination of novel motifs15. Finally, type III promoters have an Inr element only or an Inr element plus a downstream promoter element (DPE). These promoters are preferentially associated with developmentally regulated genes, the expression of which is precisely coordinated across different cells in a tissue or anatomical structure16.”[16]
With no TATA box detected in either direction for A1BG, it is likely A1BG is either type II or III. Although A1BG does not have Inrs at either apparent TSSs, there appear to be Inrs nearby suggesting multiple TSSs. Since several DPEs occur at or very close to their necessary locations relative to the TSSs on both sides, type III cannot be eliminated.
Regarding hypothesis 1: The C and D boxes are not involved in the transcription of A1BG.
There are no D boxes in the core or proximal promoters.
There are no C boxes in the core promoter, but there is one C box 3′-ACATCA-5′ at 4116 in the proximal promoter. The closest D box is in the distal promoter: 3′-AGTCTG-5′ at 3923 also on the negative strand in the positive direction, 193 nts from the C box in the proximal promoter.
On the negative strand in the negative direction there is a C box 3′-AGTAGT-5′ at 2944 and a D box 3′-AGTCTG-5′ at 2947, where the last AGT in the C box is the first 3 nts in the D box. If intron processing benefits from such overlap then a C/D snoRNA may result. If C/D box separation or exact juxtaposition is required then any of the other pairs may produce a C/D snoRNA.
A Google scholar search using key words: “C box”, “D box”, and A1BG produced zero results. This coupled with the predominant occurrence of the C/D box motif in introns indicates that hypothesis 1 is true.
Regarding hypothesis 2: If involved it assists transcription by other TFs.
The presence of one C box overlapping a D box suggests each could assist the other when present perhaps including nts in between. Although other non-C/D snoRNA TFs may be nearby, an additional literature search is needed to produce examples of actual demonstration of assisted transcription of any kind. As such, “if involved” is likely false. “It assists transcription by other TFs” is undemonstrated at present and assumed false although examples may be found disproving this. The two false components of hypothesis 2 may mean (1) if uninvolved in A1BG transcription, it can assist transcription by other TFs also uninvolved in A1BG transcriptions or (2) it can assist transcription by other TFs independent of their involvement in the transcription of A1BG.
Regarding hypothesis 3: C and D boxes occur only in the proximal promoter.
This hypothesis is proven false by C and D boxes occurring in both distal promoters.
Conclusions
The C and D boxes are not involved in the transcription of A1BG. The presence of these boxes in both distal promoters suggests introns for nearby genes.
Laboratory evaluations
To assess your example, including your justification, analysis and discussion, I will provide such an assessment of my example for comparison and consideration.
Evaluation
No wet chemistry experiments were performed to confirm that Gene ID: 1 may be transcribed from either side using C and D boxes in distal promoters. The NCBI database is generalized, whereas individual human genome testing could demonstrate that A1BG is transcribed from either side using C and D boxes though this is unlikely unless A1BG is wholely or in part of one or more C/D snoRNAs. Sufficient nts have been added to the data sets for the ZNF497 side to confirm likely transcription of A1BG.
Acknowledgements
The content on this page was first contributed by: Henry A. Hoff.
Initial content for this page in some instances came from Wikiversity.
See also
References
- ↑ 1.0 1.1 1.2 1.3 Dmitry A.Samarsky, Maurille J.Fournier, Robert H.Singer and Edouard Bertrand (1 July 1998). “The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization” (PDF). The European Molecular Biology Organization (EMBO) Journal. 17 (13): 3747–3757. doi:10.1093/emboj/17.13.3747. PMID 9649444. Retrieved 2017-02-04.
- ↑ Jennifer E.F. Butler, James T. Kadonaga (October 15, 2002). “The RNA polymerase II core promoter: a key component in the regulation of gene expression”. Genes & Development. 16 (20): 2583–292. doi:10.1101/gad.1026202. PMID 12381658.
- ↑ Stephen T. Smale and James T. Kadonaga (July 2003). “The RNA Polymerase II Core Promoter” (PDF). Annual Review of Biochemistry. 72 (1): 449–79. doi:10.1146/annurev.biochem.72.121801.161520. PMID 12651739. Retrieved 2012-05-07.
- ↑ Thomas Shafee and Rohan Lowe (9 March 2017). “Eukaryotic and prokaryotic gene structure” (PDF). WikiJournal of Medicine. 4 (1): 2. doi:10.15347/wjm/2017.002. Retrieved 2017-04-06.
- ↑ Koichi Takayama, Ken-ichirou Morohashi, Shin-ichlro Honda, Nobuyuki Hara and Tsuneo Omura (1 July 1994). “Contribution of Ad4BP, a Steroidogenic Cell-Specific Transcription Factor, to Regulation of the Human CYP11A and Bovine CYP11B Genes through Their Distal Promoters”. The Journal of Biochemistry. 116 (1): 193–203. doi:10.1093/oxfordjournals.jbchem.a124493. Retrieved 2017-08-16.
- ↑ Michelle Craig Barton, Navid Madani, and Beverly M. Emerson (8 July 1997). “Distal enhancer regulation by promoter derepression in topologically constrained DNA in vitro”. Proceedings of the National Academy of Sciences of the United States of America. 94 (14): 7257–62. Retrieved 2017-08-16.
- ↑ A Aoyama, T Tamura, K Mikoshiba (March 1990). “Regulation of brain-specific transcription of the mouse myelin basic protein gene: function of the NFI-binding site in the distal promoter”. Biochemical and Biophysical Research Communications. 167 (2): 648–53. doi:10.1016/0006-291X(90)92074-A. Retrieved 2012-12-13.
- ↑ J Gao and L Tseng (June 1996). “Distal Sp3 binding sites in the hIGBP-1 gene promoter suppress transcriptional repression in decidualized human endometrial stromal cells: identification of a novel Sp3 form in decidual cells”. Molecular Endocrinology. 10 (6): 613–21. doi:10.1210/me.10.6.613. Retrieved 2012-12-13.
- ↑ Peter Pasceri, Dylan Pannell, Xiumei Wu, and James Ellis (July 15, 1998). “Full activity from human β-globin locus control region transgenes requires 5′ HS1, distal β-globin promoter, and 3′ β-globin sequences”. Blood. 92 (2): 653–63. Retrieved 2012-12-13.
- ↑ 10.0 10.1 RefSeq (12 May 2018). “GAS5 growth arrest specific 5 (non-protein coding) [ Homo sapiens (human) ]”. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2018-05-12.
- ↑ 11.0 11.1 Satu Nahkuri, Ryan J. Taft, Darren J. Korbie and John S. Mattick (12 September 2008). “Molecular Evolution of the HBII-52 snoRNA Cluster”. Journal of Molecular Biology. 381 (4): 810–815. doi:10.1016/j.jmb.2008.06.057. Retrieved 2018-05-16.
- ↑ 12.0 12.1 Kevin Roy and Guillaume F. Chanfreau (2012). “Eukaryotic RNases and their Partners in RNA Degradation and Biogenesis, Part A, In: The Enzymes“. sciencedirect. Retrieved 2018-05-16.
- ↑ 13.0 13.1 13.2 Yannick Delpu, Dorian Larrieu, Marion Gayral, Dina Arvanitis, Marlène Dufresne, Pierre Cordelier, Jérôme Torrisani (2016). Gerda Egger and Paola Arimondo, ed. “Noncoding RNAs, In: Drug Discovery in Cancer Epigenetics“. sciencedirect. pp. 305–326. ISBN 978-0-12-802208-5. Retrieved 2018-05-16.
- ↑ 14.0 14.1 14.2 RJ Taft, EA Glazov, N Cloonan, C Simons, S Stephen, GJ Faulkner, T, Lassmann, AR Forrest, SM Grimmond, K Schroder, K Irvine, T Arakawa, M Nakamura, A Kubosaki, K Hayashida, C Kawazu, M Murata, H Nishiyori, S Fukuda, J Kawai, CO Daub, DA Hume, H Suzuki, V Orlando, P Carninci, Y Hayashizaki, JS Mattick (May 2009). “Tiny RNAs associated with transcription start sites in animals”. Nature Genetcs. 41 (5): 572–8. doi:10.1038/ng.312. Retrieved 2018-05-16.
- ↑ 15.0 15.1 15.2 15.3 15.4 Markus Brameier, Astrid Herwig, Richard Reinhardt, Lutz Walter, Jens Gruber (1 January 2011). “Human box C/D snoRNAs with miRNA like functions: expanding the range of regulatory RNAs”. Nucleic Acids Research. 39 (2): 675–686. doi:10.1093/nar/gkq776. Retrieved 2018-05-16.
- ↑ 16.0 16.1 16.2 Boris Lenhard, Albin Sandelin and Piero Carninci (April 2012). “Metazoan promoters: emerging characteristics and insights into transcriptional regulation” (PDF). Nature Reviews Genetics. 13: 233–245. Retrieved 2018-04-30.
- ↑ Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (October 2004). “Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma”. Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460. Retrieved 2011-11-28.
- ↑ 18.0 18.1 Weizmann Institute of Science (2017). “Zinc Finger Protein 497”. Israel: Weizmann Institute of Science. Retrieved 2017-08-20.
- ↑ Annie Charbonneau and Van-Luu The (26 January 2001). “Genomic organization of a human 5β-reductase and its pseudogene and substrate selectivity of the expressed enzyme”. Biochimica et Biophysica Acta (BBA) – Gene Structure and Expression. 1517 (2): 228–235. doi:10.1016/S0167-4781(00)00278-5. Retrieved 2017-11-17.
- ↑ Weiwei Deng, Hua Ying, Chris A. Helliwell, Jennifer M. Taylor, W. James Peacock, and Elizabeth S. Dennis (19 April 2011). “FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis”. Proceedings of the National Academy of Sciences United States of America. 108 (16): 6680–6685. doi:10.1073/pnas.1103175108. Retrieved 2017-09-17.
- ↑ 21.0 21.1 21.2 21.3 21.4 Deena Schmidt and Rick Durrett (1 December 2004). “Adaptive Evolution Drives the Diversification of Zinc-Finger Binding Domains”. Molecular Biology and Evolution. 21 (12): 2326–2339. doi:10.1093/molbev/msh246. Retrieved 2017-10-16.
- ↑ H Eiberg, ML Bisgaard, J Mohr (1 December 1989). “Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG”. Clinical genetics. 36 (6): 415–8. PMID 2591067. Retrieved 2017-10-08.
- ↑ John R. Stehle Jr., Mark E. Weeks, Kai Lin, Mark C. Willingham, Amy M. Hicks, John F. Timms, Zheng Cui (January 2007). “Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice”. Biochimica et Biophysica Acta (BBA) – General Subjects. 1770 (1): 79–86. Retrieved 2017-10-08.
- ↑ 24.0 24.1 24.2 24.3 Caitrin W. McDonough, Yan Gong, Sandosh Padmanabhan, Ben Burkley, Taimour Y. Langaee, Olle Melander, Carl J. Pepine, Anna F. Dominiczak, Rhonda M. Cooper-DeHoff, Julie A. Johnson (June 2013). “Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes” (PDF). Hypertension. 62 (1): 48–54. doi:10.1161/HYPERTENSIONAHA.111.00823. PMID 23690342. Retrieved 2017-10-08.
- ↑ 25.00 25.01 25.02 25.03 25.04 25.05 25.06 25.07 25.08 25.09 25.10 25.11 25.12 25.13 25.14 25.15 Cissi Gardmo and Agneta Mode (1 December 2006). “In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression”. Journal of Molecular Endocrinology. 37 (3): 433–441. doi:10.1677/jme.1.02116. Retrieved 2017-09-01.
- ↑ RefSeq (November 2015). “VEGFA vascular endothelial growth factor A [Homo sapiens (human)]”. 8600 Rockville Pike, Bethesda 0894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2018-05-22.
External links
© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH
