Health Dictionary AI Health Chat Find an Online Doctor

SCAN domain

“The SCAN domain is a highly conserved, leucine-rich motif of approximately 60 aa originally found within a subfamily of zinc finger proteins.”[1]

“The SCAN domain (named after SRE-ZBP, CTfin51, AW-1 and Number 18 cDNA) is found in several pfam00096 proteins. The domain has been shown to be able to mediate homo- and hetero-oligomerization.”[2]

SRE-ZBP

The “SRE-ZBP [is] a human zinc finger protein that binds to the c-Fos serum response element (17)”.[3]

“The promoters of many genes whose transcription is rapidly and transiently induced following growth factor or mitogen stimulation of susceptible cells contain a common regulatory element, the serum response element (SRE).”[4]

“The serum response element (SRE), a region of the c-fos gene which controls growth factor-induced transcription, is […] shown to mediate c-fos transcription in response to activation of L-type voltage-sensitive calcium channels. Calcium-dependent transcriptional activation through the SRE is mediated by the serum response factor (SRF). Membrane depolarization induces phosphorylation of SRF at Ser-103, an event shown to enhance the ability of SRF to bind the SRE.”[5]

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[5]

“Less flexibility has been attributed to the backbone structure of Z-DNA than to B-DNA (Wang et al., 1979). Initially, Z-DNA was seen in crystal structures of molecules which have strict alternations of purines and pyrimidines involving GC and AT base pairs (Wang et al., 1979, 1984). However, it has recently been shown that Z-DNA will also form in the structure d(CGATCG) in which the cytosines are methylated or brominated on the C5 position (Wang et al., 1985) as well as the brominated d(CGCGATCGCG) (Feigon et al., 1985). In this non-alternating purine/pyrimidine sequence, the thymidines assume the syn conformation and the deoxyadenosines are in the anti conformation thereby preserving the dinucleotide repeat. The resulting deformations in the d(CGATCG) backbone are comparable in magnitude with those described above for a Z-DNA sequence having a wobble GT base pair. Thus, even though it is less flexible, the Z-DNA structure represents an energy minimum which can accommodate a number of modifications in base sequence and base pairing without major changes in the backbone conformation.”[6]

Gene ID: 81030 is ZBP1 Z-DNA binding protein 1. “This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.”[7]

CTfin51

“This expression pattern in testis has been described for other C2H2-type zinc-finger proteins in mouse and human, like CTfin51, Zpf29, Sp1, and Zpf37.”[8]

Gene ID: 7589 is ZSCAN21 zinc finger and SCAN domain containing 21.[9] Mouse ortholog is Gene ID: 22697 Zscan21 zinc finger and SCAN domain containing 21 also known as RU49; Zfp38; Zfp-38; Zipro1; CTfin51; AI326272.[10]

AW-1

AW-1 is ZNF174.[11]

Gene ID: 7727 is ZNF174 zinc finger protein 174. “This gene encodes a protein with three Cys2-His2-type zinc fingers in the carboxy-terminus, a putative nuclear localization signal, and an amino-terminus SCAN box which forms homodimers. This protein is believed to function as a transcriptional repressor. Alternative splicing results in multiple transcript variants encoding distinct isoforms.”[12] Aka AW-1 and zinc finger and SCAN domain-containing protein 8.[12]

Number 18 cDNA

“The SCAN box, a leucine-rich region, was named after SRE-ZBP, CTfin51, AW-1 (ZNF174), number 18 cDNA (ZnF20) [53].”[13]

Gene ID: 7568 is ZNF20 zinc finger protein 20.[14]

pfam00096 proteins

“The Pfam database is a large collection of protein families, each represented by multiple sequence alignments and hidden Markov models (HMMs).”[15]

“Proteins are generally composed of one or more functional regions, commonly termed domains. Different combinations of domains give rise to the diverse range of proteins found in nature. The identification of domains that occur within proteins can therefore provide insights into their function.”[15]

“Pfam also generates higher-level groupings of related entries, known as clans. A clan is a collection of Pfam entries which are related by similarity of sequence, structure or profile-HMM.”[15]

“The data presented for each entry is based on the UniProt Reference Proteomes but information on individual UniProtKB sequences can still be found by entering the protein accession. Pfam full alignments are available from searching a variety of databases, either to provide different accessions (e.g. all UniProt and NCBI GI) or different levels of redundancy.”[15]

Family: zf-C2H2 (PF00096), “The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [2].”[16]

See also

References

  1. RefSeq (January 2011). “SCAND1 SCAN domain containing 1 [ Homo sapiens (human) ]”. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 19 December 2019.
  2. NCBI (2017). “Conserved Protein Domain Family SCAN”. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 19 December 2019.
  3. Gina Pengue, Viola Calabro, Paola Cannada Bartoli, Alfredo Pagliuca and Luigi Lania (1994). “Repression of transcriptional activity at a distance by the evolutionarily conserved KRAB domain present in a subfamily of zinc finger proteins” (PDF). Nucleic Acids Research. 22 (15): 2908–14. Retrieved 19 December 2019.
  4. Richard Treisman (October 1992). “The serum response element”. Trends in Biochemical Sciences. 17 (10): 423–26. doi:10.1016/0968-0004(92)90013-Y. Retrieved 19 December 2019.
  5. 5.0 5.1 Ravi P. Misra, Azad Bonni, Cindy K. Miranti, Victor M. Rivera, Morgan Sheng, and Michael E.Greenberg (14 October 1994). “L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway” (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. Retrieved 7 December 2019.
  6. Pui S. Ho, Christin A. Frederick, Gary J. Quigley, Gijs A. van der Marel, Jacques H. van Boom, Andrew H.-J. Wang and Alexander Rich (1985). “G∙T wobble base-pairing in Z-DNA at 1.0 Å atomic resolution: the crystal structure of d(CGCGTG)”. The EMBO Journal. 4 (13A): 3617–23. doi:10.1002/j.1460-2075.1985.tb04125.x. Retrieved 19 December 2019.
  7. RefSeq (December 2011). “ZBP1 Z-DNA binding protein 1 [ Homo sapiens (human) ]”. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 19 December 2019.
  8. Oscar de Luis, Luis Andrés, López-Fernández and Jesús del Mazo1 (June 1999). “Tex27, a gene containing a zinc-finger domain, is up-regulated during the haploid stages of spermatogenesis”. Experimental Cell Research. 249 (2): 320–326. doi:10.1006/excr.1999.4482. Retrieved 20 December 2019.
  9. HGNC (12 August 2019). “ZSCAN21 zinc finger and SCAN domain containing 21 [ Homo sapiens (human) ]”. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 21 December 2019.
  10. MGI (12 August 2019). “Zscan21 zinc finger and SCAN domain containing 21 [ Mus musculus (house mouse) ]”. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 21 December 2019.
  11. Leonard C. Edelstein and Tucker Collins (10 October 2005). “The SCAN domain family of zinc finger transcription factors”. Gene. 359: 1–17. doi:10.1016/j.gene.2005.06.022. Retrieved 19 December 2019.
  12. 12.0 12.1 RefSeq (December 2016). “ZNF174 zinc finger protein 174 [ Homo sapiens (human) ]”. U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 19 December 2019.
  13. Yiwei Liu, Xing Zhang, Robert M. Blumenthal, and Xiaodong Cheng (April 2013). “A common mode of recognition for methylated CpG”. Trends in Biochemical Sciences. 38 (4): 177–83. Retrieved 21 December 2019.
  14. HGNC (10 December 2019). “ZNF20 zinc finger protein 20 [ Homo sapiens (human) ]”. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 21 December 2019.
  15. 15.0 15.1 15.2 15.3 S. El-Gebali, J. Mistry, A. Bateman, S.R. Eddy, A. Luciani, S.C. Potter, M. Qureshi, L.J. Richardson, G.A. Salazar, A. Smart, E.L.L. Sonnhammer, L. Hirsh, L. Paladin, D. Piovesan, S.C.E. Tosatto, R.D. Finn (September 2018). “Pfam 32.0 (September 2018, 17929 entries)”. Meyerhofstraße 1 69117 Heidelberg, Germany: European Molecular Biology Laboratory (EMBL). Retrieved 19 December 2019.
  16. S Boehm, D Frishman and HW Mewes (June 1997). “Variations of the C2H2 zinc finger motif in the yeast genome and classification of yeast zinc finger proteins” (PDF). Nucleic Acids Research. 25 (12): 2464–9. doi:10.1093/nar/25.12.2464. PMID 9171100. Retrieved 19 December 2019.

Template:Sisterlinks

© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH