Serum response elements
Associate Editor(s)-in-Chief: Henry A. Hoff
“The serum response element (SRE), a region of the c-fos gene which controls growth factor-induced transcription, is […] shown to mediate c-fos transcription in response to activation of L-type voltage-sensitive calcium channels. Calcium-dependent transcriptional activation through the SRE is mediated by the serum response factor (SRF). Membrane depolarization induces phosphorylation of SRF at Ser-103, an event shown to enhance the ability of SRF to bind the SRE.”[1]
The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[1]
Human genes
Gene ID: 2353 is FOS Fos proto-oncogene, AP-1 transcription factor subunit. “The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. In some cases, expression of the FOS gene has also been associated with apoptotic cell death.”[2] “Serum response factor and the (CC(A/T)6GG) (CArG) box interact to promote the transcription of c-fos and muscle genes”.[3]
- NP_005243.1 proto-oncogene c-Fos, cd14721 Location:147 → 200, bZIP_Fos; Basic leucine zipper (bZIP) domain of the oncogene Fos (Fos): a DNA-binding and dimerization domain.[2]
Acknowledgements
The content on this page was first contributed by: Henry A. Hoff.
Initial content for this page in some instances came from Wikiversity.
See also
References
- ↑ 1.0 1.1 Ravi P. Misra, Azad Bonni, Cindy K. Miranti, Victor M. Rivera, Morgan Sheng, and Michael E.Greenberg (14 October 1994). “L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway” (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. Retrieved 7 December 2019.
- ↑ 2.0 2.1 RefSeq (July 2008). “FOS Fos proto-oncogene, AP-1 transcription factor subunit [ Homo sapiens (human) ]”. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 11 January 2020.
- ↑ Wataru Nishida, Mako Nakamura, Syunsuke Mori, Masanori Takahashi, Yasuyuki Ohkawa, Satoko Tadokoro, Kenji Yoshida, Kunio Hiwada, Ken’ichiro Hayashi, and Kenji Sobue (1 March 2002). “A Triad of Serum Response Factor and the GATA and NK Families Governs the Transcription of Smooth and Cardiac Muscle Genes” (PDF). The Journal of Biological Chemistry. 277 (9): 7308–7317. doi:10.1074/jbc.M111824200. Retrieved 11 January 2020.
External links
© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH
