HY box gene transcription laboratory
Editor-In-Chief: Henry A. Hoff
A laboratory is a specialized activity where a student, teacher, or researcher can have hands-on, or as close to hands-on as possible, experience actively analyzing an entity, source, or object of interest.
Usually, expensive equipment, instruments, and/or machinery are available for taking the entity apart to see and accurately record how it works, what it’s made of, and where it came from. This may involve simple experiments to test reality, collect data, and try to make some sense out of it.
Expensive equipment can be replaced or substituted for with more readily available tools.
Notations
Notations
You are free to create your own notation or use that already presented. A method to statistically assess your locator is also needed.
Laboratory control group
Laboratory control group
A laboratory control group of some large number of laboratory test subjects or results may be used to define normal limits for the presence of an effect.
Instructions
Instructions
This laboratory is an activity for you to explore the universe for, to create a method for, or to examine. While it is part of the {{Gene project}}, it is also independent.
Some suggested entities to consider are
- available classification,
- human genes,
- eukaryotes,
- nucleotides,
- classical physics quantities, or
- geometry.
More importantly, there are your entities.
You may choose to define your entities or use those already available.
Usually, research follows someone else’s ideas of how to do something. But, in this laboratory you can create these too.
This is a gene project laboratory, but you may create what a laboratory, or a {{Gene project}} is.
Yes, this laboratory is structured.
I will provide an example. The rest is up to you.
Questions, if any, are best placed on the Discuss page.
To include your participation in each of these laboratories create a subpage of your user page once you register at wikiversity and use this subpage, for example, your online name/laboratory effort.
Enjoy learning by doing!
Hypotheses
Hypotheses
- A1BG is not transcribed by an HY box.
Introduction
Introduction
A core responsive element is the hypertrophy region HY box between -89 and -60 nucleotides (nts) upstream from the transcription start site.[1]
“Deletion analysis by a series of 5′-deletion constructs identified the responsive region to RUNX-2 as being between −81 bp and −76 bp, containing a putative RUNX-2 binding sequence (TGAGGG), which is similar to that identified in the promoter region of human interleukin-3 (TGTGGG) (33).”[1] This suggests a consensus sequence of 3′-TG(A/T)GGG-5′ on the template strand in the direction of transcription.
The gene COL10A1 “encodes the alpha chain of type X collagen, a short chain collagen expressed by hypertrophic chondrocytes during endochondral ossification. Unlike type VIII collagen, the other short chain collagen, type X collagen is a homotrimer.”[2]
Human COL10A1, GeneID: 1300, has an HY box as the core responsive element.[1]
Core promoters
Core promoters

{{free media}}The core promoter is approximately -34 nts upstream from the TSS.
From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.
From the first nucleotide just after ZNF497 to the first nucleotide just before A1BG are 4300 nucleotides. The core promoter on this side of A1BG extends from approximately 4266 to the possible transcription start site at nucleotide number 4300.
Def. “the factors, including RNA polymerase II itself, that are minimally essential for transcription in vitro from an isolated core promoter” is called the basal machinery, or basal transcription machinery.[4]
Proximal promoters
Proximal promoters
Def. a “promoter region [juxtaposed to the core promoter that] binds transcription factors that modify the affinity of the core promoter for RNA polymerase.[12][13]“[5] is called a proximal promoter.
The proximal sequence upstream of the gene that tends to contain primary regulatory elements” is a proximal promoter.
It is approximately 250 base pairs or nucleotides, nts upstream of the transcription start site.
The proximal promoter begins about nucleotide number 4210 in the negative direction.
The proximal promoter begins about nucleotide number 4050 in the positive direction.
Distal promoters
Distal promoters
The “upstream regions of the human CYP11A and bovine CYP11B genes [have] a distal promoter in each gene. The distal promoters are located at −1.8 to −1.5 kb in the upstream region of the CYP11A gene and −1.5 to −1.1 kb in the upstream region of the CYP11B gene.”[6]
“Using cloned chicken βA-globin genes, either individually or within the natural chromosomal locus, enhancer-dependent transcription is achieved in vitro at a distance of 2 kb with developmentally staged erythroid extracts. This occurs by promoter derepression and is critically dependent upon DNA topology. In the presence of the enhancer, genes must exist in a supercoiled conformation to be actively transcribed, whereas relaxed or linear templates are inactive. Distal protein–protein interactions in vitro may be favored on supercoiled DNA because of topological constraints.”[7]
Distal promoter regions may be a relatively small number of nucleotides, fairly close to the TSS such as (-253 to -54)[8] or several regions of different lengths, many nucleotides away, such as (-2732 to -2600) and (-2830 to -2800).[9]
The “[d]istal promoter is not a spacer element.”[10]
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460.
If there are any transcription factors between ZN497 and A1BG, they are inside the gene for ZN497 as there are only 858 nts between them. Some 4300 nts are now in the data extending just past ZN497 to A1BG.
Samplings
Samplings
Once you’ve decided on an entity, source, or object, compose a method, way, or procedure to explore it.
One way is to perceive (see, feel, hear, taste, or touch, for example) if there are more than one of them.
Ask some questions about it.
Does it appear to have a spatial extent?
Is there any change over time?
Can it be profiled with a kind of spectrum for example, by emitted radiation? Sample by plotting two or more apparent variables against each other, like intensity versus wavelength.
Is there some location, time, intensity, where there isn’t one?
Regarding hypotheses 1:
A1BG has four possible transcription directions:
- on the negative strand from ZSCAN22 to A1BG,
- on the positive strand from ZSCAN22 to A1BG,
- on the negative strand from ZNF497 to A1BG, and
- on the positive strand from ZNF497 to A1BG.
For each transcription promoter that interacts directly with RNA polymerase II holoenzyme, the four possible consensus sequences need to be tested on the four possible transcription directions, even though some genes may only be transcribed from the negative strand in the 3′-direction on the transcribed strand.
For the Basic programs (starting with SuccessablesHY.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
- negative strand in the negative direction is SuccessablesHY–.bas, looking for 3′-TG(A/T)GGG-5′, 1, 3′-TGTGGG-5′ at 749,
- negative strand in the positive direction is SuccessablesHY-+.bas, looking for 3′-TG(A/T)GGG-5′, 4, 3′-TGAGGG-5′, 258, 3′-TGAGGG-5′, 3479, 3′-TGAGGG-5′, 3879, 3′-TGTGGG-5′, 4395,
- positive strand in the negative direction is SuccessablesHY+-.bas, looking for 3′-TG(A/T)GGG-5′, 5, 3′-TGAGGG-5′ at 88, 3′-TGAGGG-5′ at 2699, 3′-TGAGGG-5′ at 3652, 3′-TGTGGG-5′ at 3712, 3′-TGAGGG-5′ at 4558,
- positive strand in the positive direction is SuccessablesHY++.bas, looking for 3′-TG(A/T)GGG-5′, 2, 3′-TGTGGG-5′, 2965, 3′-TGTGGG-5′, 3533,
- complement, negative strand, negative direction is SuccessablesHYc–.bas, looking for 3′-AC(A/T)CCC-5′, 0,
- complement, negative strand, positive direction is SuccessablesHYc-+.bas, looking for 3′-AC(A/T)CCC-5′, 2, 3′-ACACCC-5′, 2965, 3′-ACACCC-5′, 3533,
- complement, positive strand, negative direction is SuccessablesHYc+-.bas, looking for 3′-AC(A/T)CCC-5′, 1 , 3′-ACACCC-5′, 749,
- complement, positive strand, positive direction is SuccessablesHYc++.bas, looking for 3′-AC(A/T)CCC-5′, 4, 3′-ACTCCC-5′, 258, 3′-ACTCCC-5′, 3479, 3′-ACTCCC-5′, 3879, 3′-ACACCC-5′, 4395,
- inverse complement, negative strand, negative direction is SuccessablesHYci–.bas, looking for 3′-CCC(A/T)CA-5′, 4, 3′-CCCTCA-5′, 2702, 3′-CCCACA-5′, 3184, 3′-CCCTCA-5′, 3889, 3′-CCCTCA-5′, 4498,
- inverse complement, negative strand, positive direction is SuccessablesHYci-+.bas, looking for 3′-CCC(A/T)CA-5′, 3, 3′-CCCTCA-5′, 88, 3′-CCCTCA-5′, 3207, 3′-CCCTCA-5′, 3503,
- inverse complement, positive strand, negative direction is SuccessablesHYci+-.bas, looking for 3′-CCC(A/T)CA-5′, 0,
- inverse complement, positive strand, positive direction is SuccessablesHYci++.bas, looking for 3′-CCC(A/T)CA-5′, 5, 3′-CCCTCA-5′, 494, 3′-CCCTCA-5′, 662, 3′-CCCTCA-5′, 1783, 3′-CCCACA-5′, 1803, 3′-CCCTCA-5′, 3185,
- inverse, negative strand, negative direction, is SuccessablesHYi–.bas, looking for 3′-GGG(A/T)GT-5′, 0,
- inverse, negative strand, positive direction, is SuccessablesHYi-+.bas, looking for 3′-GGG(A/T)GT-5′, 5, 3′-GGGAGT-5′, 494, 3′-GGGAGT-5′, 662, 3′-GGGAGT-5′, 1783, 3′-GGGTGT-5′, 1803, 3′-GGGAGT-5′, 3185,
- inverse, positive strand, negative direction, is SuccessablesHYi+-.bas, looking for 3′-GGG(A/T)GT-5′, 4, 3′-GGGAGT-5′, 2702, 3′-GGGTGT-5′, 3184, 3′-GGGAGT-5′, 3889, 3′-GGGAGT-5′, 4498,
- inverse, positive strand, positive direction, is SuccessablesHYi++.bas, looking for 3′-GGG(A/T)GT-5′, 3, 3′-GGGAGT-5′, 88, 3′-GGGAGT-5′, 3207, 3′-GGGAGT-5′, 3503.
Verifications
Verifications
To verify that your sampling has explored something, you may need a control group. Perhaps where, when, or without your entity, source, or object may serve.
Another verifier is reproducibility. Can you replicate something about your entity in your laboratory more than 3 times. Five times is usually a beginning number to provide statistics (data) about it.
For an apparent one time or perception event, document or record as much information coincident as possible. Was there a butterfly nearby?
Has anyone else perceived the entity and recorded something about it?
Gene ID: 1, includes the nucleotides between neighboring genes and A1BG. These nucleotides can be loaded into files from either gene toward A1BG, and from template and coding strands. These nucleotide sequences can be found in Gene transcriptions/A1BG. Copying the above discovered HY boxes and putting the sequences in “⌘F” locates these sequences in the same nucleotide positions as found by the computer programs.
Core promoter HY boxes
Core promoter HY boxes
From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.
There are no HY boxes in the core promoter between 4425 and 4460 nts.
From the first nucleotide just before ZNF497 to the first nucleotide just before A1BG are 4300 nucleotides. The core promoter on this side of A1BG extends from approximately 4264 to the possible transcription start site at nucleotide number 4300.
There are no HY boxes in the core promoter between 4264 and 4300 nts, but there is a downstream enhancer box 3′-TGTGGG-5′, at 4395, that may be involved A1BG transcription on the negative strand in the positive direction.
Proximal promoter HYs
Proximal promoter HYs
The proximal promoter begins about nucleotide number 4210 in the negative direction.
No HY boxes occur between 4210 and 4460 nts.
The proximal promoter begins about nucleotide number 4050 in the positive direction.
No HY boxes occur between 4050 and 4300 nts.
Distal promoter HYs
Distal promoter HYs
Using an estimate of 2 knts in the negative direction, a distal promoter to A1BG would be expected after nucleotide number 2460.
HY boxes occur on the positive strand in the negative direction at 3′-TGAGGG-5′ at 2699, 3′-TGAGGG-5′ at 3652, 3′-TGTGGG-5′ at 3712, and on the negative strand in the negative direction at 3′-CCCTCA-5′, 2702, 3′-CCCACA-5′, 3184, 3′-CCCTCA-5′, 3889 in the distal promoter.
Using an estimate of 2 knts in the positive direction, a distal promoter to A1BG would be expected after nucleotide number 2300.
HY boxes occur on the negative strand in the positive direction: 3′-TGAGGG-5′ at 3479 and 3′-TGAGGG-5′ at 3879. Others occur on the positive strand in the positive direction: 3′-TGTGGG-5′ at 2965 and 3′-TGTGGG-5′ at 3533. Complements that are additional on the negative strand in the positive direction occur at 3′-CCCTCA-5′, 3207 and 3′-CCCTCA-5′, 3503, and on the positive strand in the positive direction: 3′-CCCTCA-5′ at 3185.
Transcribed HY boxes
Transcribed HY boxes
Previous transcriptions have used HY boxes in the core promoters.
Laboratory reports
Laboratory reports
Below is an outline for sections of a report, paper, manuscript, log book entry, or lab book entry. You may create your own, of course.
Gene A1BG transcription using an HY box
by —Marshallsumter (discuss • contribs) 03:51, 30 September 2017 (UTC)
Abstract
The hypothesis that A1BG is not transcribed by an HY box has been tested using nucleotide sequences between ZSCAN22 and A1BG in the negative direction toward A1BG. It has been tested between ZNF497 and A1BG in the positive direction toward A1BG. HY boxes were not found in either core promoters or the proximal promoters in either direction. However, HY boxes were found in the distal promoters between ZSCAN22 and A1BG and between ZNF497 and A1BG.
Introduction
According to one source, A1BG is transcribed from the direction of ZNF497: 3′ – 58864890: CGAGCCACCCCACCGCCCTCCCTTGG+1GGCCTCATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCGACCATCATG : 58866601-5′,[11] where the second ‘G’ at left of four Gs in a row is the TSS.[12] Transcription was triggered in cell cultures and the transcription start site was found using reverse transcriptase. But, the mechanism for transcription is unknown.
Controlling the transcription of A1BG may have significant immune function against snake envenomation. A1BG forms a complex that is similar to those formed between toxins from snake venom and A1BG-like plasma proteins. These inhibit the toxic effect of snake venom metalloproteinases or myotoxins and protect the animal from envenomation.[13]
Many transcription factors (TFs) occur upstream and occasionally downstream of the transcription start site (TSS), in a gene’s promoter. It isn’t known which, if any, assist in locating and affixing the transcription mechanism for A1BG. This examination is the first to test one such DNA-occurring TF: the HY box.
Experiments
The hypothesis required at least one computer experiment to look for HY boxes on either side of A1BG. As the limited literature on transcription by HY boxes describes only such boxes in the core or proximal promoters, these HY box locations were expected.
Results
The HY boxes found are within the core or proximal promoters of ZSCAN22 and ZNF497 so they may be used to transcribe these two genes. No genes are described as transcribed from HY boxes in any distal promoters although A1BG has HY boxes on both sides in the distal promoters. A downstream HY box was found on each side of A1BG inside the gene.
Discussion
Either A1BG can be transcribed by HY boxes in the distal promoter, or A1BG is not transcribed by HY boxes. As the literature appears absent from a Google Scholar advanced search to confirm possible transcription from distal promoters, wet chemistry experiments are needed to test the possibility.
Conclusion
A1BG has not been found to be transcribed by HY boxes in either the core or proximal promoters. Wet chemistry experiments are needed to test the possibility of transcription using distal promoters.
Laboratory evaluations
Laboratory evaluations
To assess your example, including your justification, analysis and discussion, I will provide such an assessment of my example for comparison and consideration.
Evaluation
No wet chemistry experiments were performed to confirm that Gene ID: 1 is transcribed from either side using HY boxes, especially in the distal promoters. The NCBI database is generalized, whereas individual human genome testing could demonstrate that A1BG is transcribed from either side.
See also
See also
References
References
- ↑ 1.0 1.1 1.2 Akiro Higashikawa, Taku Saito, Toshiyuki Ikeda, Satoru Kamekura, Naohiro Kawamura, Akinori Kan, Yasushi Oshima, Shinsuke Ohba, Naoshi Ogata, Katsushi Takeshita, Kozo Nakamura, Ung-Il Chung, Hiroshi Kawaguchi (January 2009). “Identification of the core element responsive to runt-related transcription factor 2 in the promoter of human type x collagen gene”. Arthritis & Rheumatism. 60 (1): 166–78. doi:10.1002/art.24243. PMID 19116917. Retrieved 2013-06-18.
- ↑ HGNC (June 9, 2013). COL10A1 collagen, type X, alpha 1 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2013-06-18.
- ↑ Jennifer E.F. Butler, James T. Kadonaga (October 15, 2002). “The RNA polymerase II core promoter: a key component in the regulation of gene expression”. Genes & Development. 16 (20): 2583–292. doi:10.1101/gad.1026202. PMID 12381658.
- ↑ Stephen T. Smale and James T. Kadonaga (July 2003). “The RNA Polymerase II Core Promoter” (PDF). Annual Review of Biochemistry. 72 (1): 449–79. doi:10.1146/annurev.biochem.72.121801.161520. PMID 12651739. Retrieved 2012-05-07.
- ↑ Thomas Shafee and Rohan Lowe (9 March 2017). “Eukaryotic and prokaryotic gene structure” (PDF). WikiJournal of Medicine. 4 (1): 2. doi:10.15347/wjm/2017.002. Retrieved 2017-04-06.
- ↑ Koichi Takayama, Ken-ichirou Morohashi, Shin-ichlro Honda, Nobuyuki Hara and Tsuneo Omura (1 July 1994). “Contribution of Ad4BP, a Steroidogenic Cell-Specific Transcription Factor, to Regulation of the Human CYP11A and Bovine CYP11B Genes through Their Distal Promoters”. The Journal of Biochemistry. 116 (1): 193–203. doi:10.1093/oxfordjournals.jbchem.a124493. Retrieved 2017-08-16.
- ↑ Michelle Craig Barton, Navid Madani, and Beverly M. Emerson (8 July 1997). “Distal enhancer regulation by promoter derepression in topologically constrained DNA in vitro”. Proceedings of the National Academy of Sciences of the United States of America. 94 (14): 7257–62. Retrieved 2017-08-16.
- ↑ A Aoyama, T Tamura, K Mikoshiba (March 1990). “Regulation of brain-specific transcription of the mouse myelin basic protein gene: function of the NFI-binding site in the distal promoter”. Biochemical and Biophysical Research Communications. 167 (2): 648–53. doi:10.1016/0006-291X(90)92074-A. Retrieved 2012-12-13.
- ↑ J Gao and L Tseng (June 1996). “Distal Sp3 binding sites in the hIGBP-1 gene promoter suppress transcriptional repression in decidualized human endometrial stromal cells: identification of a novel Sp3 form in decidual cells”. Molecular Endocrinology. 10 (6): 613–21. doi:10.1210/me.10.6.613. Retrieved 2012-12-13.
- ↑ Peter Pasceri, Dylan Pannell, Xiumei Wu, and James Ellis (July 15, 1998). “Full activity from human β-globin locus control region transgenes requires 5′ HS1, distal β-globin promoter, and 3′ β-globin sequences”. Blood. 92 (2): 653–63. Retrieved 2012-12-13.
- ↑ Michael David Winther, Leah Christine Knickle, Martin Haardt, Stephen John Allen, Andre Ponton, Roberto Justo De Antueno, Kenneth Jenkins, Solomon O. Nwaka, Y. Paul Goldberg (July 29, 2004). Fat Regulated Genes, Uses Thereof and Compounds for Mudulating Same. US Patent Office. Retrieved 2013-02-14.
- ↑ HGNC (February 5, 2013). A1BG alpha-1-B glycoprotein [ Homo sapiens ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2013-02-14.
- ↑ Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (October 2004). “Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma”. Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460.
|access-date=requires|url=(help)
External links
External links
- Bing Advanced search
- Google Books
- Google scholar Advanced Scholar Search
- JSTOR
- Lycos search
- NCBI All Databases Search
- Office of Scientific & Technical Information
- PubChem Public Chemical Database
- Questia – The Online Library of Books and Journals
- SAGE journals online
- Scirus for scientific information only advanced search
- SpringerLink
- Taylor & Francis Online
- Wiley Online Library Advanced Search
- Yahoo Advanced Web Search
Looking for the patient version?
© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH
