Health Dictionary Find a Doctor

Haplogroup I1a (Y-DNA)

In human genetics, Haplogroup I1a (M253, M307, P30, P40) is a Y-chromosome haplogroup occurring at greatest frequency in Scandinavia. It displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. Bryan Sykes in his book Blood of the Isles & his other book Saxons, Vikings & Celts gives the populations associated with I1a the name of the nordic deity Wodan for a clan patriarch, much as he did for mitochondrial haplogroups in his work The Seven Daughters of Eve.

Outside Fennoscandia, distribution of Haplogroup I1a is closely correlated with that of Haplogroup I1b2; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I1a. It is conjectured that this shared ancestral population of I1a and I2b, distinct from I1b1*, may have weathered the last ice age in a refuge located somewhere in the Iberian Peninsula or southern France, or perhaps the Italian Peninsula; after the end of the ice age, some of them headed northward and repopulated Northwest Europe and Scandinavia. This population appears to have carried haplogroups I1a and I1b2 at significant frequencies, with a numerical superiority of Haplogroup I1a. Their descendants are primarily found among the Germanic populations of Northern Europe and the bordering Uralic and Celtic populations. Although even in traditionally Germanic demographics, the carriers of I1a are often overshadowed by the more prevalent carriers of Haplogroup R.

When SNPs are unknown or untested, haplogroup I1a can be predicted correctly with a very high rate of accuracy as having 8 allele repeats at DYS 455. The said value of which is nearly exclusive & ubiquitous to the I1a haplogroup, with only a very few having a 7, 9 or otherwise different STR value at that marker.

Modal haplotypes of I1a

Professor Ken Nordtvedt has given the following ‘modal haplotypes‘ within the I1a haplogroup according to examples found in I1a populations.[1]

I1a Anglo-Saxon (I1a-AS) Has its peak gradient in the Germanic lowland countries: north Germany, Denmark, the Netherlands, as well as the British Isles & old Norman regions of France. Template:DYS Template:DYS

I1a Norse (I1a-N) Has its peak gradient in Sweden. Template:DYS Template:DYS

I1a Norse-Bothnia (I1a-N-Finn) Has its peak gradient in Finland. Template:DYS Template:DYS

I1a Ultra-Norse Type 1 (I1a-uN1) Has its peak gradient in Norway. Template:DYS Template:DYS

Technical specification of mutation

Technical specification of mutation

The technical details of M253 are:

Nucleotide change: C to T
Position (base pair): 283
Total size (base pairs): 400
Forward 5′→ 3′: gcaacaatgagggtttttttg
Reverse 5′→ 3′: cagctccacctctatgcagttt
Subclades

Subclades

  • I1a (M253, M307, P30, P40, S62, S63, S64, S65, S66)
    • I1a*
    • I1a1 (M227) formerly I1a4
      • I1a1a (M72) formerly I1a3
    • I1a2 (M21)
Relationship to other haplogroups

Relationship to other haplogroups

Template:Y-DNA

Template:Clade

Famous individuals in Y-Haplogroup I1a

Famous individuals in Y-Haplogroup I1a

Alexander Hamilton, through genealogy and the testing of his descendants, has been placed within Y-DNA haplogroup I1a.[2][3].

References

References

See also

See also

External links

Template:WikiDoc Sources

Looking for the patient version?

Back to the patient-friendly article

© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH