Health Dictionary AI Health Chat Find an Online Doctor

Haplogroup R1b (Y-DNA)

File:Y-Haplogroup R1 distribution.png
Distribution of R1a (purple) and R1b (red).

In human genetics, Haplogroup R1b is the most frequent Y-chromosome haplogroup in Western Europe.

Its frequency is highest in Western Europe, especially in Atlantic Europe (and due to European emigration, in North America, South America, and Australia). In southern England, the frequency of R1b is about 70%, and in parts of north and western England, Spain, Portugal, France, Wales, and Ireland, the frequency of R1b is greater than 90%.

Nomenclature

Nomenclature

Haplogroup R1b is defined by the presence of single nucleotide polymorphism (SNP) M343, which was discovered in 2004.[1] From 2002 to 2005, R1b was defined by the presence of SNP P25; prior to 2002, today’s Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18.[2]

Bryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve. Stephen Oppenheimer also deals with this population group in his book Origins of the British.

Subclades

R1b is a descendant of Haplogroup R1, which is defined by the presence of SNP marker M173.

  • R1b (M343)
    • R1b*
    • R1b1 (P25)
      • R1b1*
      • R1b1a (M18)
      • R1b1b (M73)
      • R1b1c (M269, S3, S10, S13, S17)
        • R1b1c*
        • R1b1c1 (M37)
        • R1b1c2 (M65)
        • R1b1c3 (M126)
        • R1b1c4 (M153)
        • R1b1c5 (M160)
        • R1b1c6 (SRY2627 (M167))
        • R1b1c7 (M222)
        • R1b1c8 (P66)
        • R1b1c9 (S21)
          • R1b1c9*
          • R1b1c9a (L1 or S26)
          • R1b1c9b (S29)
        • R1b1c10 (S28)
      • R1b1d (M335)

R1b1c

Most of the present-day European males with the M343 marker also have the P25 and M269 markers. These markers define the R1b1c subclade.

This subgroup is believed by some to have existed before the last Ice Age and has been associated with the Aurignacian culture[3] (32,000 – 21,000 BC). Although the precise route of the M269 marker is not known, it has been theorized to originate in Central Asia/South Central Siberia. Archeological evidence supports the view of the arrival of Aurignacian culture to Anatolia from Europe during the Upper Paleolithic rather than from the Iranian plateau[4]. It could have entered prehistoric Europe from the area of Ukraine/Belarus or Central Asia (Kazakhstan) via the coasts of the Black Sea and the Baltic Sea. It is considered widespread in Europe throughout the Paleolithic already before the last Ice Age.[5]

Traditionally this culture is associated with the Cro-Magnon people, the first modern humans to enter Europe. However, this view has recently been challenged.[6] The people of the Aurignacian culture were the first documented human artists, making sophisticated cave paintings. Famous sites include Lascaux in France, Cueva de las Monedas in Spain and Valley of Foz Côa in Portugal (the largest open-air site in Europe).

File:Europe20000ya.png
European LGM refuges, 20 kya.

The glaciation of the ice age intensified, and the continent became increasingly uninhabitable. The genetic diversity narrowed through founder effects and population bottlenecks, as the population became limited to a few coastal refugia in Southern Europe. The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian peninsula (Portugal and Spain), where the R1b1c haplogroup may have achieved genetic homogeneity. As conditions eased with the Allerød Oscillation in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from Iberia to Scandinavia, so evident in haplogroup maps.

An alternative belief is that R1b represents the Western or centum-speaking branch of the Proto-Indo-Europeans, although this remains uncertain.

A second R1b1c population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying Y-STR markers, appear to have survived alongside other haplogroups in Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1.

Note that haplogroup R1b and haplogroup R1a first existed at very different times. The mutations that characterize haplogroup R1b occurred ~30,000 years bp, whereas the mutations that characterize haplogroup R1a occurred ~10,000 years bp.

(Note that in earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time (from 2003 to 2005) what is now R1b1c was designated R1b3. This shows how nomenclature can evolve as new markers are discovered and then investigated).

To date about 50% of R1b1c (M269+) men are negative for all of the known R1b1c subclades and are therefore classed as members of the paragroup R1b1c*. R1b1c* is not a subclade. Men of varying haplotypes and places of ancestral origin comprise its membership. Thus R1b1c* should not be considered as a single clade-like entity with any single geographic locus.

R1b1c4 (M153): This haplogroup has been found so far in 39 individuals, most of them Basques, the rest were likely of Iberian ancestry or have not been classified ethnically[7]. The first time it was located (Bosch 2001[8]) it was described as H102 and included 7 Basques and one Andalusian.

R1b1c6 (SRY2627 (M167)): The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999[9]. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.

In 2000, Rosser[10] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%) Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.

In 2001, Bosch[11] described this marker as H103, in 5 Basques and 5 Catalans. Further regional studies[12] have located it in significative amounts in Asturias, Cantabria and Galicia, as well as again among Basques. Cases in the Azores and Latin America have also been reported. A total of 85 individuals with this haplogroup have been found so far, almost all of them in academic studies, making it the best documented R1b1c subclade[13].

The subclade R1b1c7 (M222), on the other hand, is associated with the Irish and Scots; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as R1b1c7-M222 is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.

The R1b1c9 (S21) subclade, although recently discovered by EthnoAncestry, appears to be the most common downstream marker from R1b1c appearing in over 35% of those tested. This group has a maximum in Frisia (the Netherlands) and, in general, is the predominant R1b haplogroup. It may have originated towards the end of the last ice age, or perhaps more or less 7000 BC, possibly in the northern European mainland.[2] The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their “U106”) by Sims et al (2007) [3].

The R1b1c9a subclade is defined by the L1/S26 SNP and is downsteam of S21. It occurs in less than a half a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1 was first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry. L1/S26 is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or “null439“. FTDNA displays null alleles at DYS439 with a Blue 12 on public pages, and with a Blue asterisk beside 439 on personal results pages. Other testing companies do report detecting null 439s. For further information, see the null439 project at [4].

The R1b1c9b subclade is defined by S29 and is downsteam of S21. It was discovered by EthnoAncestry, and has to date been found primarily in southern England (although this may reflect a sampling bias). Recent findings show that it also occurs in Germany in the region previously inhabited by the Saxons. Further studies will serve to ascertain whether this is a native Briton marker, or Continental and having arrived in England with the Anglo – Saxons in the 5th Century.

The R1b1c10 (S28) subclade’s discovery was announced in 2005 by EthnoAncestry. Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. Ethnoancestry’s commercial and research branches have shown that S28 is found from Greece westward to the Bay of Biscay in France. It appears to follow the distribution of the La Tene Celtic peoples. The percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both S21 and S28. Like S21, S28’s specifications were not initially officially published by EthnoAncestry against their previous assertions that data would be publicly published; but again the marker was subsequently identified independently (as their “U152”) by Sims et al (2007). [5]

The newest Y-SNP to surface is S68, which was reported by EthnoAncestry in 2007. It was originally considered to be what was once referred to as a “private SNP” and by EthnoAncestry as a “Family SNP”, but was recently seen in someone from another part of Europe, and with a different surname. It is only with continued research that the time depth of these markers can be estimated. At present S68 has been seen in an individual from Scotland and another from Sweden. EthnoAncestry has determined that this subclade (tentatively identified as R1b1c11) is unlikely to be found in much more than 2% of the R1b population and is thus not considered a polymorphism.

Other subclades

Populations characterised as R1b1a (M18), R1b1b (M73), and R1b1d (M335), with those mutually exclusive distinctive markers but no M269 have been found, in Sardinia, Eurasia, and Anatolia respectively. It is presumed that these are descendants of R1b1 populations which found other refuges from the ice.

An apparent R1b1* population has been found among the Ouldeme of Northern Cameroon in west central Africa. [6] [7]

Modal haplotypes

Within the R1b haplogroup are modal haplotypes. One of the best-characterized of these haplotypes is the Atlantic Modal Haplotype (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and in the British Isles. In the Iberian Peninsula it reaches 33% in Portugal.

There also exists a haplotype of R1b with the DYS393=12 which is known in the literature as Haplotype 35, or ht35, as opposed to the AMH which is known as haplotype 15. They can be found in high numbers in Southeastern Europe and Western Asia. The members of this haplotype are thought to be descended from early R1b’s who found shelter in Anatolia during the Last Glacial Maximum instead of in Iberia. They can be found in high numbers in the Armenian Highland and Armenia with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 in Uyghur populations in western China, which is thought to be a remnant of the Tocharians, an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until they were later absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, perhaps through Roman soldiers. For further information and different subgroups of ht35, see [8] .

Niall of the Nine Hostages

In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with Niall of the Nine Hostages, an Irish king in the Dark Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1c7.

Relationship to other haplogroups

Relationship to other haplogroups

Template:Y-DNA

Template:Clade

Technical specification of mutation

Technical specification of mutation

The technical details of M343 are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs): 424
Forward 5′→ 3′: tttaacctcctccagctctgca
Reverse 5′→ 3′: acccccacatatctccagg

This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two “primer” strands listed.

See also

See also

References

References

  1. Cinnioğlu, Cengiz (January 2004). “Excavating Y-chromosome haplotype strata in Anatolia”. Human Genetics. 114 (2): 127–148. doi:10.1007/s00439-003-1031-4. Unknown parameter |coauthors= ignored (help); |access-date= requires |url= (help)
  2. Y Chromosome Consortium (2002-01-18). “YCC NRY Tree 2002”. Retrieved 2007-12-13. Check date values in: |date= (help)
  3. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective – Ornella Semino et al., 2000
  4. Excavating Y-chromosome haplotype strata in Anatolia, Cinnioglu et al., 2003
  5. International Society of Genetic Genealogy (ISOGG) – haplogroup R
  6. Rapid ecological turnover and its impact on Neanderthal and other human populations – Clive Finlayson and Jose´ S. Carrión, Trends in Ecology & Evolution, Volume 22, Issue 4 , April 2007, Pages 213-222 [1]
  7. McEwan’s Genealogy Page: “R1b1c4 aka M153”
  8. Bosch et al, High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula, 2001
  9. M.E. Hurles et al, Recent Male-Mediated Gene Flow over a Linguistic Barrier in Iberia, Suggested by Analysis of a Y-Chromosomal DNA Polymorphism, 1999
  10. Z.H. Rosser et al, Y-Chromosomal Diversity in Europe Is Clinal and Influenced Primarily by Geography, Rather than by Language, 2000
  11. Bosch et al High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula, 2001
  12. McEwan Genealogy Page: “M167 aka SRY2627 R1b1c6 subclade”
  13. McEwan’s Genealogy Page: “Summary of published results in the R subclade”
External links

Template:WikiDoc Sources

Looking for the patient version?

Back to the patient-friendly article

© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH