Health Dictionary AI Health Chat Find an Online Doctor

Hypoxia-inducible factor gene transcriptions

Associate Editor(s)-in-Chief: Henry A. Hoff

“HIF-1 is a heterodimeric transcription factor composed of HIF-1α and HIF-1β [27].”[1]

“We recently discovered a strongly conserved distal 5′ [hypoxia response element] HRE and suggested that it might contribute to oxygen-regulated [Erythropoietin] EPO expression.18 This 5′ HRE resides within a DNaseI hypersensitive site – 9.2 kb upstream of the EPO transcriptional start site, [WT CATACGTGCAGGGAGACACA], contains both the 5′-ACGTG-3′ core [hypoxia-inducible factor] HIF DNA binding site as well as the ancillary 5′-CACA-3′ element,11 and confers hypoxia-inducible exogenous reporter gene expression in Epo expressing and non-expressing cell lines.18[2]

Human genes

Human genes

Gene expressions

Gene expressions

“We have previously shown for PAG1, another HIF-2 target gene, that a single distal – 82 kb 5′ HRE resides in an isolated DNA region, bound by many additional transcription factors, and forms multiple chromatin loops both locally and over a long distance with the promoter region.21 While in this case HIF-2α did interact with the HRE, neither hypoxia nor the presence of HIF was needed for the long-range chromatin interaction with the promoter region. Only the presence of the core 5′-ACGTG-3′ HIF binding DNA sequence was required to maintain this interaction, suggesting that preformed chromatin loops enable oxygen-regulated conditional gene regulation. This model has subsequently been confirmed for many other HIF target genes by genomewide approaches.38,39 Therefore, the EPO 5′ HRE might well be functionally required for hypoxia-inducible gene expression by maintaining a constitutive chromatin architecture that supports promoter activity in a cell type-specific manner. The finding that only additional large but not small 5′ HRE deletions fully abrogated endogenous Epo induction and HIF:promoter interaction in 3′ HRE mutant Kelly cells suggests that, like in the case of the PAG1 gene, additional transcription factors bind close to the consensus HRE sequence and are involved in chromatin looping and trans-activation of the EPO promoter. We still have no explanation why a small 5′ HRE deletion alone inhibited HIF-promoter interaction, but in combination with a 3′ HRE mutation partially rescued the inhibitory effect of the 3′ HRE mutation. Nonetheless, it is without precedent that the extended 5′ HRE strongly cis-enhanced HIF binding to the promoter and 3′ HRE.”[2]

Interactions

Interactions

Consensus sequences

Consensus sequences

The binding site for HIF-1 is GCCCTACGTGCTGTCTCA.[1]

HIF-1 samplings

HIF-1 samplings

HIF-1 samplings

Copying a portion of the consensus sequence for the HIF of GCCCTACGTGCTGTCTCA and putting it in “⌘F” finds none located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be ACTCTGTCGTGCATCCCG found by the computer programs.

For the Basic programs testing consensus sequence GCCCTACGTGCTGTCTCA (starting with SuccessablesHIF.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for GCCCTACGTGCTGTCTCA, 0.
  2. negative strand, positive direction, looking for GCCCTACGTGCTGTCTCA, 0.
  3. positive strand, negative direction, looking for GCCCTACGTGCTGTCTCA, 0.
  4. positive strand, positive direction, looking for GCCCTACGTGCTGTCTCA, 0.
  5. complement, negative strand, negative direction, looking for CGGGATGCACGACAGAGT, 0.
  6. complement, negative strand, positive direction, looking for CGGGATGCACGACAGAGT, 0.
  7. complement, positive strand, negative direction, looking for CGGGATGCACGACAGAGT, 0.
  8. complement, positive strand, positive direction, looking for CGGGATGCACGACAGAGT, 0.
  9. inverse complement, negative strand, negative direction, looking for TGAGACAGCACGTAGGGC, 0.
  10. inverse complement, negative strand, positive direction, looking for TGAGACAGCACGTAGGGC, 0.
  11. inverse complement, positive strand, negative direction, looking for TGAGACAGCACGTAGGGC, 0.
  12. inverse complement, positive strand, positive direction, looking for TGAGACAGCACGTAGGGC, 0.
  13. inverse negative strand, negative direction, looking for ACTCTGTCGTGCATCCCG, 0.
  14. inverse negative strand, positive direction, looking for ACTCTGTCGTGCATCCCG, 0.
  15. inverse positive strand, negative direction, looking for ACTCTGTCGTGCATCCCG, 0.
  16. inverse positive strand, positive direction, looking for ACTCTGTCGTGCATCCCG, 0.
Hypoxia-inducible factor samplings

Hypoxia-inducible factor samplings

Hypoxia-inducible factor samplings

Copying ACGTG in “⌘F” yields eight between ZSCAN22 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence ACGTG (starting with SuccessablesHxRE.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for ACGTG, 8, ACGTG at 4339, ACGTG at 3288, ACGTG at 2760, ACGTG at 2425, ACGTG at 1999, ACGTG at 1718, ACGTG at 1346, ACGTG at 1338.
  2. negative strand, positive direction, looking for ACGTG, 1, ACGTG at 570.
  3. positive strand, negative direction, looking for ACGTG, 1, ACGTG at 4237.
  4. positive strand, positive direction, looking for ACGTG, 10, ACGTG at 4342, ACGTG at 3884, ACGTG at 3342, ACGTG at 3321, ACGTG at 2961, ACGTG at 1821, ACGTG at 1471, ACGTG at 1371, ACGTG at 1219, ACGTG at 547.
  5. complement, negative strand, negative direction, looking for TGCAC, 1, TGCAC at 4237.
  6. complement, negative strand, positive direction, looking for TGCAC, 10, TGCAC at 4342, TGCAC at 3884, TGCAC at 3342, TGCAC at 3321, TGCAC at 2961, TGCAC at 1821, TGCAC at 1471, TGCAC at 1371, TGCAC at 1219, TGCAC at 547.
  7. complement, positive strand, negative direction, looking for TGCAC, 8, TGCAC at 4339, TGCAC at 3288, TGCAC at 2760, TGCAC at 2425, TGCAC at 1999, TGCAC at 1718, TGCAC at 1346, TGCAC at 1338.
  8. complement, positive strand, positive direction, looking for TGCAC, 1, TGCAC at 570.
  9. inverse complement, negative strand, negative direction, looking for CACGT, 5, CACGT at 3429, CACGT at 2863, CACGT at 2081, CACGT at 1535, CACGT at 1470.
  10. inverse complement, negative strand, positive direction, looking for CACGT, 2, CACGT at 3254, CACGT at 569.
  11. inverse complement, positive strand, negative direction, looking for CACGT, 3, CACGT at 1772, CACGT at 531, CACGT at 342.
  12. inverse complement, positive strand, positive direction, looking for CACGT, 13, CACGT at 3960, CACGT at 3883, CACGT at 3464, CACGT at 2960, CACGT at 2800, CACGT at 2681, CACGT at 2334, CACGT at 2326, CACGT at 2063, CACGT at 1786, CACGT at 1218, CACGT at 783, CACGT at 546.
  13. inverse negative strand, negative direction, looking for GTGCA, 3, GTGCA at 1772, GTGCA at 531, GTGCA at 342.
  14. inverse negative strand, positive direction, looking for GTGCA, 13, GTGCA at 3960, GTGCA at 3883, GTGCA at 3464, GTGCA at 2960, GTGCA at 2800, GTGCA at 2681, GTGCA at 2334, GTGCA at 2326, GTGCA at 2063, GTGCA at 1786, GTGCA at 1218, GTGCA at 783, GTGCA at 546.
  15. inverse positive strand, negative direction, looking for GTGCA, 5, GTGCA at 3429, GTGCA at 2863, GTGCA at 2081, GTGCA at 1535, GTGCA at 1470.
  16. inverse positive strand, positive direction, looking for GTGCA, 2, GTGCA at 3254, GTGCA at 569.

Hypoxia-inducible factor UTRs

Negative strand, negative direction: ACGTG at 4339, CACGT at 3429, ACGTG at 3288, CACGT at 2863.

Positive strand, negative direction: ACGTG at 4237.

Hypoxia-inducible factor core promoters

Positive strand, positive direction: ACGTG at 4342.

Hypoxia-inducible factor proximal promoters

Negative strand, negative direction: ACGTG at 2760.

Hypoxia-inducible factor distal promoters

Negative strand, negative direction: ACGTG at 2425, CACGT at 2081, ACGTG at 1999, ACGTG at 1718, CACGT at 1535, CACGT at 1470, ACGTG at 1346, ACGTG at 1338, and complements.

Positive strand, negative direction: CACGT at 1772, CACGT at 531, CACGT at 342.

Negative strand, positive direction: CACGT at 3254, ACGTG at 570, CACGT at 569.

Positive strand, positive direction: CACGT at 3960, ACGTG at 3884, CACGT at 3883, CACGT at 3464, ACGTG at 3342, ACGTG at 3321, ACGTG at 2961, CACGT at 2960, CACGT at 2800, CACGT at 2681, CACGT at 2334, CACGT at 2326, CACGT at 2063, ACGTG at 1821, CACGT at 1786, ACGTG at 1471, ACGTG at 1371, ACGTG at 1219, CACGT at 1218, CACGT at 783, ACGTG at 547, CACGT at 546.

Hypoxia-inducible factor random dataset samplings

Hypoxia-inducible factor random dataset samplings

  1. HIFr0: 5, ACGTG at 4343, ACGTG at 3209, ACGTG at 2399, ACGTG at 1935, ACGTG at 841.
  2. HIFr1: 3, ACGTG at 4030, ACGTG at 1857, ACGTG at 496.
  3. HIFr2: 4, ACGTG at 1697, ACGTG at 1594, ACGTG at 484, ACGTG at 99.
  4. HIFr3: 2, ACGTG at 3769, ACGTG at 1437.
  5. HIFr4: 4, ACGTG at 2287, ACGTG at 1453, ACGTG at 660, ACGTG at 386.
  6. HIFr5: 3, ACGTG at 1587, ACGTG at 712, ACGTG at 59.
  7. HIFr6: 3, ACGTG at 2905, ACGTG at 2529, ACGTG at 654.
  8. HIFr7: 3, ACGTG at 3534, ACGTG at 1856, ACGTG at 850.
  9. HIFr8: 1, ACGTG at 914.
  10. HIFr9: 2, ACGTG at 1187, ACGTG at 797.
  11. HIFr0ci: 5, CACGT at 4342, CACGT at 2592, CACGT at 2168, CACGT at 1356, CACGT at 419.
  12. HIFr1ci: 4, CACGT at 3788, CACGT at 3428, CACGT at 3298, CACGT at 191.
  13. HIFr2ci: 2, CACGT at 3409, CACGT at 3194.
  14. HIFr3ci: 4, CACGT at 4080, CACGT at 3768, CACGT at 2750, CACGT at 1482.
  15. HIFr4ci: 4, CACGT at 4410, CACGT at 4365, CACGT at 3507, CACGT at 2286.
  16. HIFr5ci: 3, CACGT at 4067, CACGT at 843, CACGT at 58.
  17. HIFr6ci: 4, CACGT at 3433, CACGT at 2925, CACGT at 2904, CACGT at 653.
  18. HIFr7ci: 3, CACGT at 1855, CACGT at 1391, CACGT at 944.
  19. HIFr8ci: 3, CACGT at 3750, CACGT at 2984, CACGT at 897.
  20. HIFr9ci: 5, CACGT at 2965, CACGT at 2698, CACGT at 1858, CACGT at 1186, CACGT at 874.

HIFr arbitrary UTRs

  1. HIFr0: ACGTG at 4343, ACGTG at 3209.
  2. HIFr6: ACGTG at 2905.
  3. HIFr0ci: CACGT at 4342.
  4. HIFr2ci: CACGT at 3409, CACGT at 3194.
  5. HIFr4ci: CACGT at 4410, CACGT at 4365, CACGT at 3507.
  6. HIFr6ci: CACGT at 3433, CACGT at 2925, CACGT at 2904.
  7. HIFr8ci: CACGT at 3750, CACGT at 2984.

HIFr alternate UTRs

  1. HIFr1: ACGTG at 4030.
  2. HIFr3: ACGTG at 3769.
  3. HIFr7: ACGTG at 3534.
  4. HIFr1ci: CACGT at 3788, CACGT at 3428, CACGT at 3298.
  5. HIFr3ci: CACGT at 4080, CACGT at 3768.
  6. HIFr5ci: CACGT at 4067.
  7. HIFr9ci: CACGT at 2965.

HIFr alternate positive direction core promoters

  1. HIFr0: ACGTG at 4343.
  2. HIFr0ci: CACGT at 4342.
  3. HIFr4ci: CACGT at 4410, CACGT at 4365.

HIFr alternate negative direction proximal promoters

  1. HIFr3ci: CACGT at 2750.
  2. HIFr9ci: CACGT at 2698.

HIFr arbitrary positive direction proximal promoters

  1. HIFr3ci: CACGT at 4080.
  2. HIFr5ci: CACGT at 4067.

HIFr arbitrary negative direction distal promoters

  1. HIFr0: ACGTG at 2399, ACGTG at 1935, ACGTG at 841.
  2. HIFr2: ACGTG at 1697, ACGTG at 1594, ACGTG at 484, ACGTG at 99.
  3. HIFr4: ACGTG at 2287, ACGTG at 1453, ACGTG at 660, ACGTG at 386.
  4. HIFr6: ACGTG at 2529, ACGTG at 654.
  5. HIFr8: ACGTG at 914.
  6. HIFr0ci: CACGT at 2592, CACGT at 2168, CACGT at 1356, CACGT at 419.
  7. HIFr4ci: CACGT at 2286.
  8. HIFr6ci: CACGT at 653.
  9. HIFr8ci: CACGT at 897.

HIFr alternate negative direction distal promoters

  1. HIFr1: ACGTG at 1857, ACGTG at 496.
  2. HIFr3: ACGTG at 1437.
  3. HIFr5: ACGTG at 1587, ACGTG at 712, ACGTG at 59.
  4. HIFr7: ACGTG at 1856, ACGTG at 850.
  5. HIFr9: ACGTG at 1187, ACGTG at 797.
  6. HIFr1ci: CACGT at 191.
  7. HIFr3ci: CACGT at 1482.
  8. HIFr5ci: CACGT at 843, CACGT at 58.
  9. HIFr7ci: CACGT at 1855, CACGT at 1391, CACGT at 944.
  10. HIFr9ci: CACGT at 2965, CACGT at 2698, CACGT at 1858, CACGT at 1186, CACGT at 874.

HIFr arbitrary positive direction distal promoters

  1. HIFr1: ACGTG at 4030, ACGTG at 1857, ACGTG at 496.
  2. HIFr3: ACGTG at 3769, ACGTG at 1437.
  3. HIFr5: ACGTG at 1587, ACGTG at 712, ACGTG at 59.
  4. HIFr7: ACGTG at 3534, ACGTG at 1856, ACGTG at 850.
  5. HIFr9: ACGTG at 1187, ACGTG at 797.
  6. HIFr1ci: CACGT at 3788, CACGT at 3428, CACGT at 3298, CACGT at 191.
  7. HIFr3ci: CACGT at 3768, CACGT at 2750, CACGT at 1482.
  8. HIFr5ci: CACGT at 843, CACGT at 58.
  9. HIFr7ci: CACGT at 1855, CACGT at 1391, CACGT at 944.
  10. HIFr9ci: CACGT at 2965, CACGT at 2698, CACGT at 1858, CACGT at 1186, CACGT at 874.

HIFr alternate positive direction distal promoters

  1. HIFr0: ACGTG at 3209, ACGTG at 2399, ACGTG at 1935, ACGTG at 841.
  2. HIFr2: ACGTG at 1697, ACGTG at 1594, ACGTG at 484, ACGTG at 99.
  3. HIFr4: ACGTG at 2287, ACGTG at 1453, ACGTG at 660, ACGTG at 386.
  4. HIFr6: ACGTG at 2905, ACGTG at 2529, ACGTG at 654.
  5. HIFr8: ACGTG at 914.
  6. HIFr0ci: CACGT at 2592, CACGT at 2168, CACGT at 1356, CACGT at 419.
  7. HIFr2ci: CACGT at 3409, CACGT at 3194.
  8. HIFr4ci: CACGT at 3507, CACGT at 2286.
  9. HIFr6ci: CACGT at 3433, CACGT at 2925, CACGT at 2904, CACGT at 653.
  10. HIFr8ci: CACGT at 3750, CACGT at 2984, CACGT at 897.
Hypoxia-inducible factor analysis and results

Hypoxia-inducible factor analysis and results

“We recently discovered a strongly conserved distal 5′ [hypoxia response element] HRE and suggested that it might contribute to oxygen-regulated [Erythropoietin] EPO expression.18 This 5′ HRE resides within a DNaseI hypersensitive site – 9.2 kb upstream of the EPO transcriptional start site, [WT CATACGTGCAGGGAGACACA], contains both the 5′-ACGTG-3′ core [hypoxia-inducible factor] HIF DNA binding site as well as the ancillary 5′-CACA-3′ element,11 and confers hypoxia-inducible exogenous reporter gene expression in Epo expressing and non-expressing cell lines.18[2]

Reals or randoms Promoters direction Numbers Strands Occurrences Averages (± 0.1)
Reals UTR negative 5 2 2.5 2.5 ± 1.5 (–4,+-1)
Randoms UTR arbitrary negative 14 10 1.4 1.2 ± 0.2
Randoms UTR alternate negative 10 10 1 1.2 ± 0.2
Reals Core negative 0 2 0 0
Randoms Core arbitrary negative 0 10 0 0
Randoms Core alternate negative 0 10 0 0
Reals Core positive 1 2 0.5 0.5 ± 0.5 (-+0,++1)
Randoms Core arbitrary positive 0 10 0 0.2 ± 0.2
Randoms Core alternate positive 4 10 0.4 0.2 ± 0.2
Reals Proximal negative 1 2 0.5 0.5 ± 0.5 (–1,+-0)
Randoms Proximal arbitrary negative 0 10 0 0.1 ± 0.1
Randoms Proximal alternate negative 2 10 0.2 0.1 ± 0.1
Reals Proximal positive 0 2 0 0
Randoms Proximal arbitrary positive 2 10 0.2 0.1 ± 0.1
Randoms Proximal alternate positive 0 10 0 0.1 ± 0.1
Reals Distal negative 11 2 5.5 5.5 ± 2.5 (–8,+-3)
Randoms Distal arbitrary negative 21 10 2.1 2.15 ± 0.05
Randoms Distal alternate negative 22 10 2.2 2.15 ± 0.05
Reals Distal positive 25 2 12.5 12.5 ± 9.5 (-+3,++22)
Randoms Distal arbitrary positive 30 10 3.0 3.05 ± 0.05
Randoms Distal alternate positive 31 10 3.1 3.05 ± 0.05

Comparison:

The occurrences of real hypoxia-inducible factors are greater than the randoms, low UTRs overlap the randoms. This suggests that the real hypoxia-inducible factors are likely active or activable.

See also

See also

References

References

  1. 1.0 1.1 Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). “Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity”. Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
  2. 2.0 2.1 2.2 Ilaria M. C. Orlando, Véronique N. Lafleur, Federica Storti, Patrick Spielmann, Lisa Crowther, Sara Santambrogio, Johannes Schödel, David Hoogewijs, David R. Mole, and Roland H. Wenger (19 December 2019). “Distal and proximal hypoxia response elements co-operate to regulate organ-specific erythropoietin gene expression”. Haematologica. 105 (12): 2774–2784. doi:10.3324/haematol.2019.236406. PMID 33256376 Check |pmid= value (help). Retrieved 6 May 2021.
External links

Looking for the patient version?

Back to the patient-friendly article

© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH