Health Dictionary AI Health Chat Find an Online Doctor

MADS box gene transcriptions

File:Vineyard peaches de.jpg
Vineyard peaches shows leaves, branches and fruit. Credit: Tobias Maschler.{{free media}}

“The MADS-box encodes a novel type of DNA-binding domain found so far in a diverse group of transcription factors from yeast, animals, and seed plants.”[1]

“The MADS-box comprises 180 nucleotides, encoding 60 amino acids […] MADS is an acronym for the four DNA-binding proteins MCM1 [minichromosome maintenance gene 1], AGAMOUS […], DEFICIENS […], and SRF [serum response factor].”[1]

The “[Antirrhinum majus mutant squamosa (squa)] SQUA is a member of a family of transcription factors which contain the MADS-box, a conserved DNA binding domain.”[2]

The “MADS-box is […] AGAGGGAAAGTACAACTGAAGAGGATAGAGAACAAGATCAATAGACAGGTGACTTT CTCAAAGAGGAGAGGTGGATTGTTGAAAAAAGCTCATGAGCTCTCTGTGCTTTGTG ATGCTGAAGTGGCTCTTATTGTCTTCTCTAATAAGGGGAAGCTATTTGAGTATTCT ACTGAT”,[2] which has 174 nucleotides (nts) and begins with the nucleotides for the amino acids RGK.[2] The six nucleotides following the MADS box are “TCTTGC”[2] which may be the additional six needed to get to 180 nts.

“RIN [Ripening Inhibitor] binds to DNA sequences known as the CA/T-rich-G (CArG) box, which is the general target of MADS box proteins (Ito et al., 2008).”[3]

Peaches

Peaches

“An AGC box (AGCCGCC) was found [from peach (Prunus persica L. Batsch cv. Loring)] between 886 and 892 bp upstream of the translation start site which has been shown in other ethylene-responsive PR genes to be a binding site for ethylene-responsive binding factor proteins (ERF proteins) (Ohme-Takagi and Shinshi, 1995; Sato et al., 1996; Jia and Martin, 1999; Fujimoto et al., 2000).”[4]

“The peach ACO1 does have an AGC box that has been found to bind ethylene responsive elements in response to pathogen infections (Ohme-Takagi et al., 2000; Rushton et al., 2002). Only the apple ACO1 also contains this sequence. In addition, both PpACO1 and the apple ACO1 have a MADS box transcription factor binding site (CarG) (Tilly et al., 1998), but none of the other ACO genes do. “[4]

See also

See also

References

References

  1. 1.0 1.1 Günter Theißen, Jan T. Kim, Heinz Saedler (1 November 1996). “Classification and phylogeny of the MADS-box multigene family suggest defined roles of MADS-box gene subfamilies in the morphological evolution of eukaryotes”. Journal of Molecular Evolution. 43 (5): 484–516. doi:10.1007/BF02337521. Retrieved 2015-03-31.
  2. 2.0 2.1 2.2 2.3 Peter Huijser, Joachim Klein, Wolf-Ekkehard Lonnig, Hans Meijer, Heinz Saedler and Hans Sommer (April 1992). “Bracteomania,an inflorescence anomaly, is caused by the loss of function of the MADS-box gene squamosa in Antirrhinum majus (PDF). The EMBO Journal. 11 (4): 1239–49. PMID 556572. Retrieved 2015-04-01.
  3. Masaki Fujisawa, Toshitsugu Nakano, Yoko Shima and Yasuhiro Ito (5 February 2013). “A large-scale identification of direct targets of the tomato MADS box transcription factor RIPENING INHIBITOR reveals the regulation of fruit ripening”. The Plant Cell. 25 (2): 371–86. doi:10.​1105/​tpc.​112.​108118 Check |doi= value (help). Retrieved 2017-02-19. zero width space character in |doi= at position 4 (help)
  4. 4.0 4.1 Hangsik Moon and Ann M. Callahan (2004). “Developmental regulation of peach ACC oxidase promoter–GUS fusions in transgenic tomato fruits”. Journal of Experimental Botany. 55 (402): 1519–28. doi:10.1093/jxb/erh162. Retrieved 2014-05-07.
External links

Template:Sisterlinks

Looking for the patient version?

Back to the patient-friendly article

© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH