Health Dictionary Find a Doctor

MADS-box gene transcriptions

Associate Editor(s)-in-Chief: Henry A. Hoff

File:Vineyard peaches de.jpg
Vineyard peaches shows leaves, branches and fruit. Credit: Tobias Maschler.{{free media}}

“The MADS-box encodes a novel type of DNA-binding domain found so far in a diverse group of transcription factors from yeast, animals, and seed plants.”[1]

“The MADS-box comprises 180 nucleotides, encoding 60 amino acids […] MADS is an acronym for the four DNA-binding proteins MCM1 [minichromosome maintenance gene 1], AGAMOUS […], DEFICIENS […], and SRF [serum response factor].”[1]

The “[Antirrhinum majus mutant squamosa (squa)] SQUA is a member of a family of transcription factors which contain the MADS-box, a conserved DNA binding domain.”[2]

The “MADS-box is […] AGAGGGAAAGTACAACTGAAGAGGATAGAGAACAAGATCAATAGACAGGTGACTTT CTCAAAGAGGAGAGGTGGATTGTTGAAAAAAGCTCATGAGCTCTCTGTGCTTTGTG ATGCTGAAGTGGCTCTTATTGTCTTCTCTAATAAGGGGAAGCTATTTGAGTATTCT ACTGAT”,[2] which has 174 nucleotides (nts) and begins with the nucleotides for the amino acids RGK.[2] The six nucleotides following the MADS box are “TCTTGC”[2] which may be the additional six needed to get to 180 nts.

“RIN [Ripening Inhibitor] binds to DNA sequences known as the CA/T-rich-G (CArG) box, which is the general target of MADS box proteins (Ito et al., 2008).”[3]

Peaches

“An AGC box (AGCCGCC) was found [from peach (Prunus persica L. Batsch cv. Loring)] between 886 and 892 bp upstream of the translation start site which has been shown in other ethylene-responsive PR genes to be a binding site for ethylene-responsive binding factor proteins (ERF proteins) (Ohme-Takagi and Shinshi, 1995; Sato et al., 1996; Jia and Martin, 1999; Fujimoto et al., 2000).”[4]

“The peach ACO1 does have an AGC box that has been found to bind ethylene responsive elements in response to pathogen infections (Ohme-Takagi et al., 2000; Rushton et al., 2002). Only the apple ACO1 also contains this sequence. In addition, both PpACO1 and the apple ACO1 have a MADS box transcription factor binding site (CarG) (Tilly et al., 1998), but none of the other ACO genes do. “[4]

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

Initial content for this page in some instances came from Wikiversity.

See also

References

  1. 1.0 1.1 Günter Theißen, Jan T. Kim, Heinz Saedler (1 November 1996). “Classification and phylogeny of the MADS-box multigene family suggest defined roles of MADS-box gene subfamilies in the morphological evolution of eukaryotes”. Journal of Molecular Evolution. 43 (5): 484–516. doi:10.1007/BF02337521. Retrieved 2015-03-31.
  2. 2.0 2.1 2.2 2.3 Peter Huijser, Joachim Klein, Wolf-Ekkehard Lonnig, Hans Meijer, Heinz Saedler and Hans Sommer (April 1992). “Bracteomania,an inflorescence anomaly, is caused by the loss of function of the MADS-box gene squamosa in Antirrhinum majus (PDF). The EMBO Journal. 11 (4): 1239–49. PMID 556572. Retrieved 2015-04-01.
  3. Masaki Fujisawa, Toshitsugu Nakano, Yoko Shima and Yasuhiro Ito (5 February 2013). “A large-scale identification of direct targets of the tomato MADS box transcription factor RIPENING INHIBITOR reveals the regulation of fruit ripening”. The Plant Cell. 25 (2): 371–86. doi:10.1105/tpc.112.108118. Retrieved 2017-02-19.
  4. 4.0 4.1 Hangsik Moon and Ann M. Callahan (2004). “Developmental regulation of peach ACC oxidase promoter–GUS fusions in transgenic tomato fruits”. Journal of Experimental Botany. 55 (402): 1519–28. doi:10.1093/jxb/erh162. Retrieved 2014-05-07.

Template:Sisterlinks

© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH