Factor II B recognition element gene transcription laboratory
Editor-In-Chief: Henry A. Hoff
{{free media}}A laboratory is a specialized activity, a construct, you create where you as a student, teacher, or researcher can have hands-on, or as close to hands-on as possible, experience actively analyzing an entity, source, or object of interest. Usually, there’s more to do than just analyzing. The construct is often a room, building or institution equipped for scientific research, experimentation as well as analysis.
In this instance, we have a context to put everything in perspective. In the room next door is an astronaut that was on the International Space Station. She has been in zero gravity, or microgravity, for several months. A physician and lab assistants have been performing tests on her. Because she has been in zero gravity for several months her body chemistry and anatomy now differs from what it was in the controlled gravity environment of Earth. She has lost about 10 % each of her bone mass, muscle mass, and brain mass. Comparisons with gene expression sequences now and when on Earth have found that the gene expression for alpha-1-B glycoprotein is not normal. If a way to correct this expression cannot be found she must be returned to Earth maybe to recover, maybe not!
But, it isn’t that simple, she’s actually on the Mars expedition, three months along on the six months to Mars. It is unlikely she will survive three more months at zero g. Worse, the microgravity may not be the only culprit. There is also the radiation of the interplanetary medium.
You have been tasked to examine her DNA for the effects of the factor II B recognition element regarding the expression of alpha-1-B glycoprotein.
The factor II B recognition element is a gene transcription factor (TF).
Factor II B recognition element
Factor II B recognition element

The B recognition element (BRE) is a DNA sequence found in the promoter region of most genes in eukaryotes and Archaea.[1][2]
The BRE is a cis-regulatory element that is found immediately upstream of the TATA box, and consists of 7 nucleotides.
In the archaean from the Dead Sea imaged at the right, “We have completely fragmented their DNA. I mean we have completely destroyed it by bombarding it with [radiation]. And they can reassemble their entire chromosome and put it back into working order within several hours.”[3]
Consensus sequences
Consensus sequences

The consensus sequence is 5’-G/C G/C G/A C G C C-3’.[4]
The general consensus sequence using degenerate nucleotides is 5’-SSRCGCC-3’, where S = G or C and R = A or G.[5]
Transcription start sites
Transcription start sites
“The position in nucleotides (nt) relative to the transcription start site (TSS, +1)” is -35 for the BRE. Of human promoters, some “22-25% [are] BRE containing promoters … the functional consensus sequences for BRE … motif [is] still poorly defined.”[5]
General transcription factor II Bs
General transcription factor II Bs
The Transcription Factor IIB (TFIIB) recognizes this sequence in the DNA, and binds to it. The fourth and fifth alpha helices of TFIIB intercalate with the major groove of the DNA at the BRE. TFIIB is one part of the preinitiation complex that helps RNA Polymerase II bind to the DNA.
Nucleotides
Nucleotides
DNA mapping has been performed. Her DNA for A1BG promoters can be found at Gene_transcriptions/A1BG#Nucleotides.
Programming
Programming
Sample programs for preparing test programs are available at A1BG gene transcription programming.
Hypotheses
Hypotheses
- B recognition factor is not involved in the transcription of A1BG.
- If involved it assists transcription by other TFs.
Core promoters
Core promoters

The core promoter is approximately -34 nts upstream from the TSS.
From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.
To extend the analysis from inside and just on the other side of ZNF497 some 3340 nts have been added to the data. This would place the core promoter some 3340 nts further away from the other side of ZNF497. The TSS would be at about 4300 nts with the core promoter starting at 4266.
Def. “the factors, including RNA polymerase II itself, that are minimally essential for transcription in vitro from an isolated core promoter” is called the basal machinery, or basal transcription machinery.[7]
Proximal promoters
Proximal promoters
Def. a “promoter region [juxtaposed to the core promoter that] binds transcription factors that modify the affinity of the core promoter for RNA polymerase.[12][13]“[8] is called a proximal promoter.
The proximal sequence upstream of the gene that tends to contain primary regulatory elements is a proximal promoter.
It is approximately 250 base pairs or nucleotides, nts, upstream of the transcription start site.
The proximal promoter begins about nucleotide number 4210 in the negative direction.
The proximal promoter begins about nucleotide number 4195 in the positive direction.
Distal promoters
Distal promoters
The “upstream regions of the human [cytochrome P450 family 11 subfamily A] CYP11A and bovine CYP11B genes [have] a distal promoter in each gene. The distal promoters are located at −1.8 to −1.5 kb in the upstream region of the CYP11A gene and −1.5 to −1.1 kb in the upstream region of the CYP11B gene.”[9]
“Using cloned chicken βA-globin genes, either individually or within the natural chromosomal locus, enhancer-dependent transcription is achieved in vitro at a distance of 2 kb with developmentally staged erythroid extracts. This occurs by promoter derepression and is critically dependent upon DNA topology. In the presence of the enhancer, genes must exist in a supercoiled conformation to be actively transcribed, whereas relaxed or linear templates are inactive. Distal protein–protein interactions in vitro may be favored on supercoiled DNA because of topological constraints.”[10]
Distal promoter regions may be a relatively small number of nucleotides, fairly close to the TSS such as (-253 to -54)[11] or several regions of different lengths, many nucleotides away, such as (-2732 to -2600) and (-2830 to -2800).[12]
The “[d]istal promoter is not a spacer element.”[13]
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460.
Any transcription factor before A1BG from the direction of ZN497 may be out to 2300 nts.
Samplings
Samplings
Regarding hypothesis 1
The B recognition element (BRE) is not involved in the transcription of A1BG.
For the Basic programs (starting with SuccessablesBRE.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
- negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesBRE–.bas, looking for 3′-(G/C)(G/C)(G/A)CGCC-5′, 3, 3′-CCACGCC-5′ at 380, 3′-CCGCGCC-5′ at 1762, and 3′-CCACGCC-5′ at 2197,
- negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesBRE-+.bas, looking for 3′-(G/C)(G/C)(G/A)CGCC-5′, 3, 3′-GCACGCC-5′, 1302, 3′-GGACGCC-5′, 1672, 3′-GGGCGCC-5′, 1769,
- positive strand in the negative direction is SuccessablesBRE+-.bas, looking for 3′-(G/C)(G/C)(G/A)CGCC-5′, 0,
- positive strand in the positive direction is SuccessablesBRE++.bas, looking for 3′-(G/C)(G/C)(G/A)CGCC-5′, 3, 3′-CCACGCC-5′, 489, 3′-CGACGCC-5′, 1033, 3′-CCACGCC-5′, 1764,
- complement, negative strand, negative direction is SuccessablesBREc–.bas, looking for 3′-G/C-G/C-C/T-G-C-G-G-5′, 1, 3′-CCTGCGG-5′ at 1153,
- complement, negative strand, positive direction is SuccessablesBREc-+.bas, looking for 3′-G/C-G/C-C/T-G-C-G-G-5′, 3, 3′-GGTGCGG-5′, 489, 3′-GCTGCGG-5′, 1033, 3′-GGTGCGG-5′, 1764,
- complement, positive strand, negative direction is SuccessablesBREc+-.bas, looking for 3′-G/C-G/C-C/T-G-C-G-G-5′, 3, 3′-GGTGCGG-5′ at 380, 3′-GGCGCGG-5′ at 1762, and 3′-GGTGCGG-5′ at 2197,
- complement, positive strand, negative direction is SuccessablesBREc++.bas, looking for 3′-G/C-G/C-C/T-G-C-G-G-5′, 3, 3′-CGTGCGG-5′, 1302, 3′-CCTGCGG-5′, 1672, 3′-CCCGCGG-5′, 1769,
- inverse complement, negative strand, negative direction is SuccessablesBREci–.bas, looking for 3′-G-G-C-G-C/T-G/C-G/C-5′, 0,
- inverse complement, negative strand, positive direction is SuccessablesBREci-+.bas, looking for 3′-G-G-C-G-C/T-G/C-G/C-5′, 1, 3′-GGCGCCC-5′, 1770,
- inverse complement, positive strand, negative direction is SuccessablesBREci+-.bas, looking for 3′-G-G-C-G-C/T-G/C-G/C-5′, 4, 3′-GGCGTGG-5′ at 1244, 3′-GGCGCGG-5′ at 1762, 3′-GGCGTGG-5′ at 1897, and 3′-GGCGTGG-5′ at 3047,
- inverse complement, positive strand, positive direction is SuccessablesBREci++.bas, looking for 3′-G-G-C-G-C/T-G/C-G/C-5′, 4, 3′-GGCGCGC-5′, 682, 3′-GGCGCCG-5′, 1338, 3′-GGCGCCG-5′, 1438, 3′-GGCGTGG-5′, 2566,
- inverse, negative strand, negative direction, is SuccessablesBREi–.bas, looking for 3′-C-C-G-C-G/A-G/C-G/C-5′, 4, 3′-CCGCACC-5′ at 1244, 3′-CCGCGCC-5′ at 1762, 3′-CCGCACC-5′ at 1897, and 3′-CCGCACC-5′ at 3047,
- inverse, negative strand, positive direction, is SuccessablesBREi-+.bas, looking for 3′-C-C-G-C-G/A-G/C-G/C-5′, 4, 3′-CCGCGCG-5′, 682, 3′-CCGCGGC-5′, 1338, 3′-CCGCGGC-5′, 1438, 3′-CCGCACC-5′, 2566,
- inverse, positive strand, negative direction, is SuccessablesBREi+-.bas, looking for 3′-C-C-G-C-G/A-G/C-G/C-5′, 0,
- inverse, positive strand, positive direction, is SuccessablesBREi++.bas, looking for 3′-C-C-G-C-G/A-G/C-G/C-5′, 1, 3′-CCGCGGG-5′, 1770.
Regarding hypothesis 2
{{fairuse}}The BRE is likely involved in and assists transcription by these other TFs when they are present.
The diagram on the right shows an overview of the four core promoter elements: B recognition element (BRE), TATA box, initiator element (Inr), and downstream promoter element (DPE), with their respective consensus sequences and their distance from the transcription start site.[6]
On the left is a more comprehensive diagram of a promoter. “The best known core promoter element is the TATA-box, consisting of an AT-rich sequence located ~27 bp upstream of the TSS, but several other core promoter elements exist, including initiator element (Inr) and X core promoter element 1 (XCPE1) localized around the TSS, the TFIIB recognition elements (BRE) that are positioned upstream of the TSS, and downstream promoter element (DPE), motif ten element (MTE) and downstream core element (DCE) that are situated downstream of TSS. The distal regulatory elements include locus control regions (LCR), enhancers, silencers and insulators. The enhancers and silencers have sites for binding multiple transcription factors and they function in activating and repressing transcription, respectively. Insulators operate by blocking genes from being affected by the regulatory elements of neighbouring genes. The LCR consists of multiple transcription regulatory elements that function together to provide proper expression regulation to a cluster of genes.”[14]
Verifications
Verifications
To verify that your sampling has explored something, you may need a control group. Perhaps where, when, or without your entity, source, or object may serve.
Another verifier is reproducibility. Can you replicate something about your entity in your laboratory more than 3 times. Five times is usually a beginning number to provide statistics (data) about it.
For an apparent one time or perception event, document or record as much information coincident as possible. Was there a butterfly nearby?
Has anyone else perceived the entity and recorded something about it?
Gene ID: 1, includes the nucleotides between neighboring genes and A1BG. These nucleotides can be loaded into files from either gene toward A1BG, and from template and coding strands. These nucleotide sequences can be found in Gene transcriptions/A1BG. Copying the above discovered HNF6s and putting the sequences in “⌘F” locates these sequences in the same nucleotide positions as found by the computer programs.
Core promoters BREs
Core promoters BREs
From the first nucleotide just after ZSCAN22 to the first nucleotide just before A1BG are 4460 nucleotides. The core promoter on this side of A1BG extends from approximately 4425 to the possible transcription start site at nucleotide number 4460.
There are no BREs (BREu) in the core promoter from approximately 4425 to the possible transcription start site at nucleotide number 4460.
From the first nucleotide just after ZNF497 to the first nucleotide just before A1BG are 858 nucleotides. The core promoter on this side of A1BG extends from approximately 824 to the possible transcription start site at nucleotide number 858. Nucleotides (nts) have been added from ZNF497 to A1BG. The TSS for A1BG is now at 4300 nts from just on the other side of ZNF497. The core promoter should now be from 4266 to 4300.
There are no BREs (BREu) in the core promoter from approximately 4266 to the possible transcription start site at nucleotide number 4300.
Proximal promoter BREs
Proximal promoter BREs
The proximal promoter begins about nucleotide number 4210 in the negative direction.
There are no BREs (BREu) in the proximal promoter beginning about nucleotide number 4210 in the negative direction.
The proximal promoter begins about nucleotide number 4050 in the positive direction.
There are no BREs (BREu) in the proximal promoter beginning about nucleotide number 4050 in the positive direction.
Distal promoter BREs
Distal promoter BREs
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2460 in the negative direction.
There is one BREu in the distal promoter: 3′-CCGCACC-5′ at 3047 on the negative strand in the negative direction and its complement on the positive strand.
Using an estimate of 2 knts, a distal promoter to A1BG would be expected after nucleotide number 2300 in the positive direction.
There is one BRE in the distal promoter: 3′-CCGCACC-5′ at 2566 on the negative strand in the positive direction and its complement on the positive strand.
Transcribed BREs
Transcribed BREs
“One of the major discoveries in large-scale detection of promoters was the existence of different classes of core promoters, for which there are common features across the metazoan lineage. The number of main classes has not been settled, but the current evidence points towards three main functional classes […].”[15]
“In D. melanogaster, a number of different promoter types have been suggested based on motif content. An exhaustive analysis of motif composition in D. melanogaster and human promoters14 revealed extensive differences in the type and directionality of motifs found in different promoters and their association with gene function. In parallel, five principal motif-based classes of D. melanogaster promoters were proposed15, which could be further grouped into three general functional classes16.”[15]
“Type I consists of the tissue-specific promoters, which are similar to the low-CpG class in mammals with respect to motif composition, stage of development at which they are expressed and tissue specificity, and they are characterized by a high enrichment for a TATA box at an appropriate distance from an initiator element (Inr element). Type II promoters are associated with ‘housekeeping’ genes and genes that are regulated at the level of individual cells; they have either a DNA recognition element (DRE) or a combination of novel motifs15. Finally, type III promoters have an Inr element only or an Inr element plus a downstream promoter element (DPE). These promoters are preferentially associated with developmentally regulated genes, the expression of which is precisely coordinated across different cells in a tissue or anatomical structure16.”[15]
Laboratory reports
Laboratory reports
Below is an outline for sections of a report, paper, manuscript, log book entry, or lab book entry. You may create your own, of course.
BREu transcription laboratory
by —Marshallsumter (discuss • contribs) 00:36, 26 April 2018 (UTC)
Abstract
Two hypotheses have been examined: (1) the B recognition element (BRE) upstream of a TATA box, if it exists, is not involved in the transcription of A1BG and (2) if involved it assists transcription by other TFs. These have been tested by literature searching articles that report upstream BREs in the promoter region of a particular human gene and by using a simple computer program to look for upstream BREs in the nucleotide sequences on either side of the A1BG gene. Both the template DNA strand and the coding strand have been checked. To show that these upstream BREs can be used during or for transcription of A1BG at least one transcription factor has been found.
Introduction
According to one source, A1BG is transcribed from the direction of ZNF497: 3′ – 58864890: CGAGCCACCCCACCGCCCTCCCTTGG+1GGCCTCATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCGACCATCATG : 58866601-5′, per Michael David Winther, Leah Christine Knickle, Martin Haardt, Stephen John Allen, Andre Ponton, Roberto Justo De Antueno, Kenneth Jenkins, Solomon O. Nwaka, and Y. Paul Goldberg, Fat Regulated Genes, Uses Thereof and Compounds for Mudulating Same, US Patent Office, July 29, 2004, at http://www.google.com/patents?hl=en&lr=&vid=USPATAPP10416914&id=7iaVAAAAEBAJ&oi=fnd&printsec=abstract#v=onepage&q&f=false where the second ‘G’ at left of four Gs in a row is the TSS. Transcription was triggered in cell cultures and the transcription start site was found using reverse transcriptase. But, the mechanism for transcription is unknown.
Controlling the transcription of A1BG may have significant immune function against snake envenomation. A1BG forms a complex that is similar to those formed between toxins from snake venom and A1BG-like plasma proteins. These inhibit the toxic effect of snake venom metalloproteinases or myotoxins and protect the animal from envenomation.[16]
TATA boxes
A1BG does not have a TATA box in the two core promoter regions.
Initiator elements
A1BG does not have Inrs at either apparent TSSs.
Downstream Promoter Elements
Several DPEs occur at or very close to their necessary locations relative to the TSSs on both sides.
Transcription factors
Many transcription factors (TFs) may occur upstream and occasionally downstream of the transcription start site (TSS), in this gene’s promoter. The following have been examined so far: (1) AGC boxes (GCC boxes), (2) ATA boxes, (3) CArG boxes, (4) enhancer boxes, (5) HY boxes, (6) metal responsive elements (MREs), (7) STAT5s, and (8) HNF6s.
AGC boxes (GCC boxes)
An AGC box was found in the distal promoter of either gene ZSCAN22 or A1BG on both the template and coding strands. But, as the only known transcription of A1BG occurs between Gene ID: 162968 ZNF497 and Gene ID: 1 A1BG, it is unlikely that this AGC box is naturally used to transcribe A1BG.
A full web search produced several references including a GeneCard[17] for “zinc finger protein 497” and “GCC box”, including “May be involved in transcriptional regulation.”[17] Zinc fingers are mentioned in association with GCC boxes in plants. It seems unlikely that an AGC box is involved in any way with the transcription of A1BG.
An extension of the nucleotide data for the positive direction from ZNF475 toward A1BG from 958 nts to 4445 nts has not discovered any AGC boxes even in the distal promoter just beyond ZNF497.
ATA boxes
Regarding hypothesis 1: there are no ATA boxes in the core promoter of A1BG from either direction or strand.
This hypothesis has been shown to be true.
A corollary hypothesis might be 1.1: there are no ATA boxes in the proximal promoter of A1BG from either direction or strand.
This corollary hypothesis may be true. “The analysis of the promoter region indicated that a putative ATA box is located 54 nucleotides upstream from the transcription start site”.[18] There is one inverse and inverse complement ATA box in the proximal promoter in the positive direction between 4050 and 4300: 3′-AAATAA-5′ at 4142, and 3′-TTTATT-5′ at 4142. As the TSS is at 4300 nts, this ATA box is some 158 nts away, where with the smaller data set 3′-TTTATT-5′ was at 703. As the TSS is at 858 nts, this ATA box is some 155 nts away, which is approximately the same number of nts from the TSS but not close enough to be in the core promoter and not 54 nts upstream from the TSS or to match other such genes with an ATA box.
But the ATA box at 2347 is likely involved in transcription of A1BG in analogy to the rat. Although this has not been confirmed as involved, the existence of this ATA box likely proves hypothesis 1 false.
Regarding hypothesis 2: ATA boxes have a role as downstream signal transducers in A1BG.
There is the following inverse ATA box on the negative strand, negative direction: 3′-AAATAA-5′ at 4537. On this strand, in this direction the TSS is at 4460 nts from ZSCAN22. This ATA box is 77 nts downstream. So far no published research has been found to verify this type of downstream promoter or enhancer ATA box. There may be another isoform TSS nearby. As such, hypothesis 2 may be true.
Regarding hypothesis 3: ATA boxes may assist transcription of A1BG by other transcription factors.
This hypothesis has been shown by literature search to be true. But, none of the ATA boxes for A1BG are close enough to any STAT5 promoter to match known transcription initiation.
CArG boxes
By combining a literature search with computer analysis of each promoter between ZSCAN22 and A1BG and ZNF497 and A1BG, CArG boxes have been found. To show that these CArG boxes may be used during or for transcription of A1BG at least one transcription factor has been affirmed.
A literature search of more recent results discovered: “Of the [Flowering Locus C] FLC binding sites, 69% contained at least one CArG-box motif with the core consensus sequence CCAAAAAT(G/A)G and an AAA extension at the 3′ end [. Three] other MADS-box flowering-time regulators, SOC1, SVP, and AGAMOUS-LIKE 24 (AGL24), bind to two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream of the translation start in the SEP3 gene (24), consistent with different specificities for the different MADS-box proteins.”[19]
These together with the core motif CC(A/T)6GG suggest a more general CArG-box motif of (C(C/A/T)(A/T)6(A/G)G). Subsequent computer-program testing revealed two more general CArG boxes: 3′-CAAAAAAAAG-5′ at 1399 nts from ZSCAN22 and 3′-CATTAAAAGG-5′ at 3441 nts from ZSCAN22, but none within 4300 nts toward A1BG from ZNF497.
These results show that the presence of CArG boxes on the ZSCAN22 side of A1BG implies their use when transcribing A1BG, although they may be pointing toward ZSCAN22. These suggest that the hypothesis (A1BG is not transcribed by a CArG box) is false. Regarding the second hypothesis (The lack of a CArG box on either side of A1BG does not prove that it is not actively used to transcribe A1BG), the presence of more general CArG boxes in the distal promoter tentatively confirms this hypothesis.
CArG boxes do occur in the distal promoter of A1BG on the ZSCAN22 side only. And, it is likely that a CArG box is involved in some way with the transcription of A1BG.
Enhancer boxes
The presence of many enhancer boxes on both sides of A1BG demonstrate that the hypothesis: “A1BG is not transcribed by an enhancer box”, is false.
The finding by literature search of evidence verifying that at least one transcription factor can enhance or inhibit the transcription of A1BG using one or more enhancer boxes disproves the hypothesis: “Existence of an enhancer box on either side of A1BG does not prove that it is actively used to transcribe A1BG”.
Enhancer boxes do occur in the proximal and distal promoters of A1BG. And, it is likely that an enhancer box is involved in some way with the transcription of A1BG.
HY boxes
HY boxes were not found in either core promoters or the proximal promoters in either direction. However, HY boxes were found in the distal promoters on both sides of A1BG. No genes are described in the literature so far as transcribed from HY boxes in any distal promoters.
Either A1BG can be transcribed by HY boxes in the distal promoter, or A1BG is not transcribed by HY boxes. As the literature appears absent from a Google Scholar advanced search to confirm possible transcription from distal promoters, wet chemistry experiments are needed to test the possibility.
Metal responsive elements
By combining a literature search with computer analysis of the promoter between ZSCAN22 and A1BG and ZNF497 and A1BG, metal responsive elements have been found. Literature search has also discovered at least three post-translational isoforms including the unaltered precursor. Although no metal responsive elements overlap any enhancer boxes in the distal promoter, there are elements in the distal promoter.
“The human genome is estimated to contain 700 zinc-finger genes, which perform many key functions, including regulating transcription. [Four] clusters of zinc-finger genes [occur] on human chromosome 19”.[20]
Nearby zinc-fingers on chromosome 19 include ZNF497 (GeneID: 162968), ZNF837 (GeneID: 116412), and ZNF8 (GeneID: 7554).
“In rodents and in humans, about one third of the zinc-finger genes carry the Krüppel-associated box (KRAB), a potent repressor of transcription (Margolin et al. 1994), […]. There are more than 200 KRAB-containing zinc-finger genes in the human genome, about 40% of which reside on chromosome 19 and show a clustered organization suggesting an evolutionary history of duplication events (Dehal et al. 2001).”[20]
ZNF8 is in cluster V along with A1BG.[20]
“In contrast to the four clusters considered [I through IV], one that occurs at the telomere of chromosome 19, which we will call cluster V, has been very stable [over mouse, rat, and human].”[20]
“Apart from the somewhat unexpected location of Zfp35 on mouse chromosome 18 and of the AIBG orthologs on mouse chromosome 15 and rat chromosome 7, there has been little rearrangement.”[20]
So far no article has reported any linkage between zinc, including various zinc fingers, or cadmium, and A1BG.
Regarding additional isoforms, mention has been made of “new genetic variants of A1BG.”[21]
“Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein (A1BG) and its post-translationally modified isoforms.”[22]
Pharmacogenomic variants have been reported. There are A1BG genotypes.[23]
A1BG has a genetic risk score of rs893184.[23]
“A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10−5).”[23]
“rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG.”[23]
For example, GeneID: 9 has isoforms: a, b, X1, and X2. Each of these (a and b) have variants. Variants 1-6 and 9 all encode the same isoform (a).
Variants 7, 8 and 10 all encode isoform b. Isoforms X1 and X2 are predicted.
Variants can differ in promoters, untranslated regions, or exons. For GeneID: 9: This variant (1) represents the longest transcript but encodes the shorter isoform (a). This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter.
This variant (2, also known as Type IID) lacks an alternate exon in the 5′ UTR, compared to variant 1. This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter.
This variant (9, also known as Type IA) has a distinct 5′ UTR and represents use of an alternate promoter known as the NATa or P3 promoter, compared to variant 1.
But, A1BG in NCBI Gene lists only one isoform, the gene locus itself, and the protein transcribed is a precursor subject to translational or more likely post-translational modifications.
The presence of multiple MREs coupled with experimental results from the literature indicating post-translational isoforms tends to confirm the existence of two or more isoforms for A1BG.
It isn’t known which, if any, assist in locating and affixing the transcription mechanism for A1BG. This examination is the first to test one such DNA-occurring TF: the HNF6s.
The presence of multiple MREs coupled with experimental results from the literature indicating post-translational isoforms tends to confirm the existence of two or more isoforms for A1BG and likely transcription from either side.
STAT5s
All three hypotheses have been addressed. Regarding hypothesis 1: STAT5s have a role as downstream signal transducers in A1BG, where the murine downstream promoter element is only 11 nts displaced from the human one. This suggests a STAT5 participation in human gene transcription of A1BG in the proximal promoter downstream between any other promoter and the TSS on the ZNF497 side of A1BG. Regarding hypothesis 2: A1BG is not transcribed by any STAT5s is clearly disproved by the STAT5 transcription factor in the proximal promoter on the ZNF497 side of A1BG. And, regarding hypothesis 3: STAT5s may assist transcription of A1BG by other transcription factors, literature search has found that STAT5s assist transcription of A1BG by other transcription factors.[24] The proximal STAT5 promoter is -58 to -50 from A1BG TSS. If another STAT5 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected.[24] A STAT5 transcription site lies at 3′-TTCCGGGAA-5′ at 4247 in the proximal promoter, i.e. from 4242 (-58) to 4250 (-50). This suggests that STAT5 assists in the transcription of A1BG.
HNF6s
Computer programs were written and run on the positive and negative strands between ZSCAN22 or ZNF497 and A1BG.
Regarding hypothesis 1: HNF6s have a role as downstream signal transducers in A1BG.
HNF6s may have a downstream proximal promoter element if the computer nts sampling is additionally, approximately at least 250 nts downstream of the transcription start site. “Downstream” can refer to downstream from an enhancer but before the transcription start site, downstream from a TATA box or an initiator element but before the transcription start site (TSS), downstream from another promoter element and containing the TSS, or downstream after the TSS. The computer programs written to test for HNF6 promoters were limited to 100 nts below the apparent TSSs.
Regarding hypotheses 2: A1BG is not transcribed by any HNF6s.
Here, the experiments have two parts: (1) are there any HNF6 promoters? and (2) are any of these used to transcribe A1BG?
The Basic programs (starting with SuccessablesHNF6.bas) were written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+) looking for 16 possible types of promoters.
Regarding hypothesis 3: HNF6s may assist transcription of A1BG by other transcription factors.
An extensive literature search was performed to find even one example of a HNF6 assist of an A1BG transcription.
Regarding hypothesis 1: HNF6s have a role as downstream signal transducers in A1BG.
(1) “Downstream” can refer to downstream from an enhancer but before the transcription start site.
There is a HNF6 on the negative strand in the positive direction (from ZNF497 to A1BG) of 3′-TTCCGGGAA-5′ at 808 in the proximal promoter, where the TSS is at 858 nts from ZNF497.
There is no such “downstream” promoter between ZSCAN22 and A1BG.
(2) “Downstream from a TATA box or an initiator element (Inr) but before the transcription start site (TSS).
Both a TATA box or an Inr are within the core promoter. There are no HNF6s within any core promoters per the computer program sampling from ZNF497 or ZSCAN22 and A1BG.
(3) “Downstream from another promoter element and containing the TSS. There are no HNF6s within any core promoters per the computer program sampling from ZNF497 or ZSCAN22 and A1BG containing either TSS.
(4) “Downstream after the TSS. No HNF6s were detected at least to 100 nts downstream of each TSS.
Regarding hypotheses 2: A1BG is not transcribed by any HNF6s.
There is a HNF6 on the negative strand in the positive direction (from ZNF497 to A1BG) of 3′-TTCCGGGAA-5′ at 808 in the proximal promoter, where the TSS is at 858 nts from ZNF497. This direction is the only confirmed transcription of A1BG; therefore, it is likely A1BG is transcribed using this HNF6 transcription factor.
There are two HNF6s on the negative strand in the negative direction, 3′-AAGCAACTT-5′ at 3506 and 3′-AAGGGACTT-5′ at 3782. Both of these are in the distal promoter between ZSCAN22 and A1BG.
Regarding hypothesis 3: HNF6s may assist transcription of A1BG by other transcription factors.
{{fairuse}}Both “the 2.3 kb and the 160 bp proximal parts of the a1bg promoter direct sex-specific expression of the reporter gene, and that a negative regulatory element resides in the −1 kb to −160 bp region.”[24]
“Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative HNF6 sites and one [hepatic nuclear factor 6] HNF6/HNF3 binding site at −2077/−2069, −69/−61 and −137/−128 respectively […].”[24]
The “GH-dependent sexually dimorphic expression conveyed by the 2.3 kb a1bg promoter is enhanced by the HNF6/HNF3 site […].”[24]
“HNF6 bound to the a1bg HNF6 oligonucleotide, but in this case, the mutated oligonucleotide was able to compete for binding when added in large excess […]. However, […] the HNF6 binding capacity of the mutated oligonucleotide was clearly reduced. A 20 molar excess of the mutated oligonucleotide had only a marginal effect on the binding of HNF6 […], whereas a 20 molar excess of unlabelled probe […] completely abolished binding. Supershift analysis with an HNF6 antibody revealed a complex with a slightly lower mobility than the HNF6 complex […]. By extending the electrophoresis run and including nuclear extract from hypophysectomized rats, devoid of GH and thereby lacking HNF6 (Lahuna et al. 1997), the two different complexes were clearly visualized. The complex with the lower mobility is most probably due to the binding of HNF3, in analogy with what was shown by Lahuna et al. for the CYP2C12 HNF6 binding site; HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997). […] HNF6 could bind to their respective site in the a1bg promoter in vitro, and the mutations introduced in respective site abolished binding of the corresponding factor.”[24]
The “expression of a −116/−89 deletion construct in which also the HNF6 site was mutated, (−116/−89) delmutHNF6-Luc, […] the generated luciferase activities were reduced in both sexes […]. This is in contrast to that mutation/deletion of the sites separately only affected the expression in female livers.”[24]
The “−116/−89 region contains a site(s) of importance for the GH-dependent and female-specific expression of the a1bg gene, and that the impact of this region together with the HNF6 site is more complex than mere enhancement of the expression in females.”[24]
Following “mutation of the HNF6-binding element, mutHNF6-Luc, the sex-differentiated expression was attenuated due to reduced expression in females. Thus, for a1bg, the sex-related difference in amount of HNF6 is likely to contribute to the sex-differentiated and female characteristic expression.”[24]
Nuclear “proteins binding to the a1bg −116/−89 region [are] members of the [nuclear factor 1] NF1 and the [octamer transcription factor] Oct families of transcription factors. NF1 genes are expressed in most adult tissues (Osada et al. 1999). It is not known how NF1 modulates transcriptional activity, and both activation and repression of transcription have been reported (Gronostajski 2000). Cofactors such as CBP/p300 and HDAC have been shown to interact with NF1 proteins suggesting modulation of chromatin structure (Chaudhry et al. 1999). NF1 factors have also been shown to interact directly with the basal transcription machinery as well as with other transcription factors, including Stat5 (Kim & Roeder 1994, Mukhopadhyay et al. 2001) and synergistic effects with HNF4 have been reported (Ulvila et al. 2004). In addition to the HNF6, Stat5 and NF1/Oct sites, the a1bg promoter harbours an imperfect HNF4 site at −51/−39 with two mismatches compared with the HNF4 consensus site. HNF4 is clearly important for the expression of CYP2C12 (Sasaki et al. 1999), however, the −51/−39 region in a1bg was not protected in the footprinting analysis and was therefore not analysed further. Like NF1, Oct proteins have been reported to be involved in activation as well as repression of gene expression (Phillips & Luisi 2000). […] Moreover, NF1 and Oct-1 have been shown to, reciprocally, facilitate each other’s binding (O’Connor & Bernard 1995, Belikov et al. 2004).”[24]
In the diagram on the right is liver “expression of a1bg-luciferase constructs. (A) Stat5 and HNF6 consensus sequences and corresponding sites in the 2.3 kb a1bg promoter alongside with the used mutations. (B) Female (black bars) and male (open bars) rats [results].”[24]
Regarding hypothesis 1: HNF6s have a role as downstream signal transducers in A1BG.
The only known TSS for A1BG lies at 4300 nts from just beyond ZNF497 toward A1BG. There two HNF6s in the proximal promoter between 4050 and 4300, 3′-TTATTGATTA-5′ at 4164 and 3′-TATAATTGTT-5′ at 4172, i.e. outside from 4242 (-58) to 4250 (-50). This suggests that HNF6 assists in the transcription of A1BG, but not downstream of the TSS.
“Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed [a] HNF6 [site] at […] −69/−61 […].”[24]
The murine downstream promoter element is only 11 nts displaced from the human one. This suggests a HNF6 participation in human gene transcription of A1BG.
Regarding hypothesis 2: A1BG is not transcribed by any HNF6s.
“Computer analysis of the 2.3 kb rat a1bg promoter fragment revealed two putative HNF6 sites […] at −2077/−2069 [and] −69/−61 […].”[24]
There are two HNF6s on the negative strand in the negative direction, 3′-AAGCAACTT-5′ at 3506 (-954) and 3′-AAGGGACTT-5′ at 3782 (-678) in the distal promoter between ZSCAN22 and A1BG. Although much closer than their likely murine counterparts, they are on the other side of A1BG from the HNF6 site confirming hypothesis 1. If active in humans or murine-like HNF6s occur within or beyond ZNF497 in this distal promoter, then human A1BG is transcribed using HNF6 promoters disproving hypothesis 2.
A Google Scholar search using ZNF497 with HNF6 found no articles discussing HNF6 sites inside or associated with ZNF497. To confirm they exist, a data file going 4300 nts to just beyond ZNF497 has been created and tested for a distal promoter on this side. Distal HNF6s in the positive direction, if they exist, would be inside ZNF497 or beyond, e.g., 3′-ATGTCCATGG-5′ at 3581 was found.
Regarding hypothesis 3: HNF6s may assist transcription of A1BG by other transcription factors.
Literature search has found that HNF6s assist transcription of A1BG by other transcription factors.[24] The proximal HNF6 promoter is -58 to -50 from A1BG TSS. If another HNF6 promoter is at -2.3 kb, it is about -1.4 kb inside ZNF497 which is 3212 nts long. Per analogy to the rat this would be expected.[24]
Per earlier laboratories transcription factors may occur in the distal promoters on the ZNF497 side of A1BG for
- ATA boxes 3′-AATAAA-5′ occurs at 3427,
- CArG boxes,
- Enhancer boxes,
- HY boxes,
- MREs and
- STAT5s 3′-TTCCATGAA-5′ occurs at 128.
The HNF6 promoter on the other side of A1BG (at about +3 kb is way beyond -2.1 through ZNF497 unless the DNA is folded to allow the HNF6 on the ZSCAN22 side to be used in analogy to the HNF6 on the same side as in the rat.[24]
All three hypotheses have been addressed. Regarding hypothesis 1: HNF6s have a role as downstream signal transducers in A1BG, where the murine downstream promoter element is only 11 nts displaced from the human one. This suggests a HNF6 participation in human gene transcription of A1BG
Experiments
Computer programs were written and run on the positive and negative strands between ZSCAN22 or ZNF497 and A1BG.
Regarding hypothesis 1: B recognition factor is not involved in the transcription of A1BG.
Here, the experiments have two parts: (1) are there any BREu promoters? and (2) are any of these used to transcribe A1BG?
The Basic programs (starting with SuccessablesBRE.bas) were written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+) looking for 16 possible types of promoters.
Regarding hypothesis 2: If involved it assists transcription by other TFs.
An extensive literature search was performed to find even one example of a BREu assist of an A1BG transcription.
Results
Regarding hypothesis 1: B recognition element (BREu) is not involved in the transcription of A1BG.
In the negative direction, there are no BREs (BREu) in the core promoter from approximately 4425 to the possible transcription start site at nucleotide number 4460.
In the positive direction, there are no BREs (BREu) in the core promoter from approximately 4266 to the possible transcription start site at nucleotide number 4300.
There are no BREs (BREu) in the proximal promoter beginning about nucleotide number 4210 in the negative direction.
There are no BREs (BREu) in the proximal promoter beginning about nucleotide number 4050 in the positive direction.
There is one BREu in the distal promoter: 3′-CCGCACC-5′ at 3047 on the negative strand in the negative direction and its complement on the positive strand.
There is one BRE in the distal promoter: 3′-CCGCACC-5′ at 2566 on the negative strand in the positive direction and its complement on the positive strand.
Regarding hypothesis 2: If involved it assists transcription by other TFs.
A search of Google Scholar and the full web failed to produce any examples of BREu assisted A1BG transcription.
“A computational study based on statistical analysis of curated promoter sets concluded that up to 25% of human core promoters contain a potential BREu. The motif was found to be enriched in CpG promoters (>30% frequency) but depleted in CpG-less promoters (<10% frequency) [14].”[25]
Discussions
“Type I consists of the tissue-specific promoters, which are similar to the low-CpG class in mammals with respect to motif composition, stage of development at which they are expressed and tissue specificity, and they are characterized by a high enrichment for a TATA box at an appropriate distance from an initiator element (Inr element). Type II promoters are associated with ‘housekeeping’ genes and genes that are regulated at the level of individual cells; they have either a DNA recognition element (DRE) or a combination of novel motifs15. Finally, type III promoters have an Inr element only or an Inr element plus a downstream promoter element (DPE). These promoters are preferentially associated with developmentally regulated genes, the expression of which is precisely coordinated across different cells in a tissue or anatomical structure16.”[15]
With no TATA box detected in either direction for A1BG, it is likely A1BG is either type II or III. Although A1BG does not have Inrs at either apparent TSSs, there appear to be Inrs nearby suggesting multiple TSSs. Since several DPEs occur at or very close to their necessary locations relative to the TSSs on both sides, type III cannot be eliminated.
There are no BREs (BREu) in the core or proximal promoters on either side of A1BG, which confirms hypothesis 1 that the B recognition factor is not involved in the transcription of A1BG.
Regarding hypothesis 2: If involved it assists transcription by other TFs.
A Google scholar search using “B recognition element” with “distal promoter” found no BRE occurring in a distal promoter as a TF or enhancer for any gene.
The presence of BREs in the distal promoters suggests additional isoforms of nearby genes.
Conclusions
The upper B recognition element is not involved in the transcription of A1BG. The presence of BREs in both distal promoters suggests nearby genes.
Laboratory evaluations
Laboratory evaluations
To assess your example, including your justification, analysis and discussion, I will provide such an assessment of my example for comparison and consideration.
Evaluation
No wet chemistry experiments were performed to confirm that Gene ID: 1 may be transcribed from either side using BREs in distal promoters. The NCBI database is generalized, whereas individual human genome testing could demonstrate that A1BG is transcribed from either side using BREs. Sufficient nts have been to the data sets for the ZNF497 side to confirm likely transcription of A1BG.
References
References
- ↑ Lagrange T, Kapanidis AN, Tang H, Reinberg D, Ebright RH (1998). “New core promoter element in RNA polymerase II-dependent transcription: sequence-specific DNA binding by transcription factor IIB”. Genes & Development. 12 (1): 34–44. doi:10.1101/gad.12.1.34. PMC 316406. PMID 9420329.
- ↑ Littlefield O, Korkhin Y, Sigler PB (1999). “The structural basis for the oriented assembly of a TBP/TFB/promoter complex”. Proceedings of the National Academy of Sciences of the USA. 96 (24): 13668–73. doi:10.1073/pnas.96.24.13668. PMC 24122. PMID 10570130.
- ↑ Adrienne Kish (September 10, 2004). “Secrets of a Salty Survivor A microbe that grows in the Dead Sea is teaching scientists about the art of DNA repair”. Washington, DC USA: NASA. Retrieved 2014-05-15.
- ↑ Alan K. Kutach, James T. Kadonaga (2000). “The Downstream Promoter Element DPE Appears To Be as Widely Used as the TATA Box in Drosophila Core Promoters” (PDF). Molecular and Cellular Biology. 20 (13): 4754–64. PMID 10848601. Retrieved 2012-07-15. Unknown parameter
|month=ignored (help) - ↑ 5.0 5.1 Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (2007). “Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters”. Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMID 17123746. Unknown parameter
|month=ignored (help) - ↑ 6.0 6.1 Jennifer E.F. Butler, James T. Kadonaga (October 15, 2002). “The RNA polymerase II core promoter: a key component in the regulation of gene expression”. Genes & Development. 16 (20): 2583–292. doi:10.1101/gad.1026202. PMID 12381658.
- ↑ Stephen T. Smale and James T. Kadonaga (July 2003). “The RNA Polymerase II Core Promoter” (PDF). Annual Review of Biochemistry. 72 (1): 449–79. doi:10.1146/annurev.biochem.72.121801.161520. PMID 12651739. Retrieved 2012-05-07.
- ↑ Thomas Shafee and Rohan Lowe (9 March 2017). “Eukaryotic and prokaryotic gene structure” (PDF). WikiJournal of Medicine. 4 (1): 2. doi:10.15347/wjm/2017.002. Retrieved 2017-04-06.
- ↑ Koichi Takayama, Ken-ichirou Morohashi, Shin-ichlro Honda, Nobuyuki Hara and Tsuneo Omura (1 July 1994). “Contribution of Ad4BP, a Steroidogenic Cell-Specific Transcription Factor, to Regulation of the Human CYP11A and Bovine CYP11B Genes through Their Distal Promoters”. The Journal of Biochemistry. 116 (1): 193–203. doi:10.1093/oxfordjournals.jbchem.a124493. Retrieved 2017-08-16.
- ↑ Michelle Craig Barton, Navid Madani, and Beverly M. Emerson (8 July 1997). “Distal enhancer regulation by promoter derepression in topologically constrained DNA in vitro”. Proceedings of the National Academy of Sciences of the United States of America. 94 (14): 7257–62. Retrieved 2017-08-16.
- ↑ A Aoyama, T Tamura, K Mikoshiba (March 1990). “Regulation of brain-specific transcription of the mouse myelin basic protein gene: function of the NFI-binding site in the distal promoter”. Biochemical and Biophysical Research Communications. 167 (2): 648–53. doi:10.1016/0006-291X(90)92074-A. Retrieved 2012-12-13.
- ↑ J Gao and L Tseng (June 1996). “Distal Sp3 binding sites in the hIGBP-1 gene promoter suppress transcriptional repression in decidualized human endometrial stromal cells: identification of a novel Sp3 form in decidual cells”. Molecular Endocrinology. 10 (6): 613–21. doi:10.1210/me.10.6.613. Retrieved 2012-12-13.
- ↑ Peter Pasceri, Dylan Pannell, Xiumei Wu, and James Ellis (July 15, 1998). “Full activity from human β-globin locus control region transgenes requires 5′ HS1, distal β-globin promoter, and 3′ β-globin sequences”. Blood. 92 (2): 653–63. Retrieved 2012-12-13.
- ↑ Alexandra Elsing (2014). “Regulation of HSF2 and its function in mitosis” (PDF). Turku, Finland: Department of Biosciences, Åbo Akademi University. p. 123. ISBN 978-952-12-3105-6. Retrieved 2018-04-22.
- ↑ 15.0 15.1 15.2 15.3 Boris Lenhard, Albin Sandelin and Piero Carninci (April 2012). “Metazoan promoters: emerging characteristics and insights into transcriptional regulation” (PDF). Nature Reviews Genetics. 13: 233–245. Retrieved 2018-4-30. Check date values in:
|accessdate=(help) - ↑ Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (October 2004). “Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma”. Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460. Retrieved 2011-11-28.
- ↑ 17.0 17.1 Weizmann Institute of Science (2017). Zinc Finger Protein 497. Israel: Weizmann Institute of Science. Retrieved 2017-08-20.
- ↑ Annie Charbonneau and Van-Luu The (26 January 2001). “Genomic organization of a human 5β-reductase and its pseudogene and substrate selectivity of the expressed enzyme”. Biochimica et Biophysica Acta (BBA) – Gene Structure and Expression. 1517 (2): 228–235. doi:10.1016/S0167-4781(00)00278-5. Retrieved 2017-11-17.
- ↑ Weiwei Deng, Hua Ying, Chris A. Helliwell, Jennifer M. Taylor, W. James Peacock, and Elizabeth S. Dennis. “FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis”. Proceedings of the National Academy of Sciences United States of America. 108 (16): 6680–6685. doi:10.1073/pnas.1103175108. Retrieved 2017-09-17. Unknown parameter
|datew=ignored (help) - ↑ 20.0 20.1 20.2 20.3 20.4 Deena Schmidt and Rick Durrett (1 December 2004). “Adaptive Evolution Drives the Diversification of Zinc-Finger Binding Domains”. Molecular Biology and Evolution. 21 (12): 2326–2339. doi:10.1093/molbev/msh246. Retrieved 2017-10-16.
- ↑ H Eiberg, ML Bisgaard, J Mohr (1 December 1989). “Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG”. Clinical genetics. 36 (6): 415–8. PMID 2591067. Retrieved 2017-10-08.
- ↑ John R. Stehle Jr., Mark E. Weeks, Kai Lin, Mark C. Willingham, Amy M. Hicks, John F. Timms, Zheng Cui (January 2007). “Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice”. Biochimica et Biophysica Acta (BBA) – General Subjects. 1770 (1): 79–86. Retrieved 2017-10-08.
- ↑ 23.0 23.1 23.2 23.3 Caitrin W. McDonough, Yan Gong, Sandosh Padmanabhan, Ben Burkley, Taimour Y. Langaee, Olle Melander, Carl J. Pepine, Anna F. Dominiczak, Rhonda M. Cooper-DeHoff, Julie A. Johnson (2013). “Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes” (PDF). Hypertension. 62 (1): 48–54. doi:10.1161/HYPERTENSIONAHA.111.00823. PMID 23690342. Retrieved 2017-10-08. Unknown parameter
|month=ignored (help) - ↑ 24.00 24.01 24.02 24.03 24.04 24.05 24.06 24.07 24.08 24.09 24.10 24.11 24.12 24.13 24.14 24.15 Cissi Gardmo and Agneta Mode (1 December 2006). “In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression”. Journal of Molecular Endocrinology. 37 (3): 433–441. doi:10.1677/jme.1.02116. Retrieved 2017-09-01.
- ↑ Thomas K Albert, Korbinian Grote, Stefan Boeing and Michael Meisterernst (15 March 2010). “Basal core promoters control the equilibrium between negative cofactor 2 and preinitiation complexes in human cells”. Genome Biology. 11: R33. doi:10.1186/gb-2010-11-3-r33. Check date values in:
|accessdate=(help);|access-date=requires|url=(help)
Looking for the patient version?
© 2026 MyEClinic – IFTM Institut für Telematik in der Medizin GmbH
